Labshake search
Citations for New England Biolabs :
2201 - 2250 of 10000+ citations for Cortisone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was digested overnight at 37°C with gentle agitation after adding 25 µl of 10x NEBuffer3 and 5 ul of 25 U/ul MboI (NEB). To biotin end-fill the DNA a 50 ul master mix containing the following was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... media in each well was aspirated and cells were incubated in 80 μL of 1x Hanks’ balanced Salt Solution with 20 mM HEPES and 10 μL 100 μM Coelenterazine-400a diluted in PBS for 5 minutes before adding either 10 μL of 5.5 U of Enterokinase (New England Biolabs #P8070S) in PBS or 10 μL of vehicle PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were harvested and lysed as described above and were run over 5 ml of Amylose affinity resin (New England Biolabs), washed with 100 ml of 20 mM sodium phosphate pH 7.2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was clarified by centrifugation at 5°C at 18 500 rpm for 30min and loaded onto gravity flow amylose resin (NEB) previously equilibrated with buffer WB1_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of each sublibrary plasmid was digested at 37°C for 5 hours with NheI-HF and SacI-HF (New England Biolabs), incubated with rSAP for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 µCi) ...
-
bioRxiv - Microbiology 2024Quote: The 5’ end of the sigAb transcript was identified using 5’ RACE following manufacturer’s protocol with template switching RT enzyme mix (NEB; M0466). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro RNA transcription was performed in 50 µl reactions: 5 µl RNAPol Reaction Buffer (New England BioLabs, Ipswich, MA), 2 µl T7 RNA Polymerase (New England BioLabs ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Plant Biology 2020Quote: ... respectively by Phusion® High-Fidelity PCR Kit (NEB) (Harashima & Schnittger ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... After purified with Monarch RNA Cleanup Kit (NEB Biolabs), RNAs were polyadenylated with E ...
-
bioRxiv - Cancer Biology 2021Quote: ... After purified with Monarch RNA Cleanup Kit (NEB Biolabs), RNAs were polyadenylated with E ...
-
bioRxiv - Molecular Biology 2020Quote: ... and qPCR analysis by NEB Next Library Quant Kit for Illumina (New England Biolabs). All sequencing was performed using an Illumina MiSeq (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: Libraries were prepared using Next Ultra II kits (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Using the NEBuilder HiFi DNA assembly cloning kit (NEB), EBOV VP30 was inserted into a pLenti6.3 vector (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: PCR fragments were assembled using Gibson assembly kit (NEB) and verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... and reverse transcribed using Lunascript kit (New England Biolabs). qPCR was performed on a Light Cycler 480 (Roche ...