Labshake search
Citations for New England Biolabs :
2401 - 2450 of 2950 citations for 7 Oxabicyclo 4.1.0 heptane 3 carboxylicacid 2 ethylhexyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 μL 12.5% Triton-X to each well to quench the SDS and 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified for 12 cycles (72 °C 5 min ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by addition of 2 μl of no SDS-purple gel loading dye (New England BioLabs) or 50% glycerol ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2021Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at −20 °C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genomics 2019Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Genetics 2021Quote: ... Cells were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in −20°C in 70% EtOH until further use.
-
bioRxiv - Genetics 2021Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Heparinase digests were performed for 2 hours at 37 °C with a mixture of Heparinase I + II and III (3.5 mUnits/ml, NEB) in Heparinase digestion buffer (20 mM Tris ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA libraries for Illumina sequencing were prepared with the NEBNext Ultra 2 DNA Library Kit for Illumina (NEB, E7645L) using 200ng of DNA and custom made unique dual indices (8bp) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were A-tailed by incubating 750 ng of DNA with 2 Units of Taq DNA Polymerase (NEB) and 0.2 mM dATP (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... without codon optimization and was inserted into pcDNA 3.1 to g et pcDNA 3.1-SARS-CoV-2-Spike using NEBuilder® HiFi DNA Assembly Master Mix (NEB) a ccording to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: The furin cleavage specificity was assayed by incubating 2.5 μg (7.6 μM) S1/S2-GB1-6xHis substrate with 2 U furin (New England Biolabs, p8077) in 30 μl reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... were assembled using 10 μl of 2× master mix at 50 °C for 1 h according to manufacturer’s instructions (NEB). 5α Competent Escherichia coli (30 μl ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Genetics 2022Quote: ... Embryos were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 4 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in 70% EtOH in −20°C no longer than 1 day before further processing.
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV transfer vectors used for 3-plex sgRNA delivery into skeletal muscle were cloned between AAV serotype 2 ITR’s including a cloning site for multiplexed hU6-sgRNA insertions (MluI and KpnI (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR reactions contained 2 μl cDNA in 50 μl PCR reaction with Phusion Hot Start Flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... doner RNA and the complementary splint DNA strand were annealed at a molar ratio of 1: 2: 1.5 in T4 DNA ligase buffer (NEB) by incubation for 3 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... Conventional PCR assays were carried out with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Australia). For some samples ...
-
bioRxiv - Plant Biology 2022Quote: ... we first created a RUBY-minus vector lacking the gene GT by assembling PCR product 1 containing CYP76AD1 and DODA and PCR product 2 containing Arabidopsis HSP18.2 terminator into a pGFPGUSplus vector 18 via NEBuilder HiFi DNA Assembly (New England BioLabs). The pAXY0006 vector of split-RUBY was generated by assembling PCR products containing f1 fragment of gene GT (named GTf1 ...
-
bioRxiv - Neuroscience 2022Quote: ... RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cell Biology 2023Quote: Protein G magnetic beads were washed 2-3x with 1ml blocking buffer (20 mM Hepes, 150 mM KCl, 20% Glycerol, 0.5 % Tween, BSA (Biolabs), Heparin 0.2 mg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.6 µL of 10X GlycoBuffer 2 (Cat.#B3704S; New England Biolabs), 2.6 µL of 10% NP-40 (Cat.#B2704S ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of PURExpress sample was mixed with 300 ng of ΦX174 Virion DNA (ssDNA substrate, NEB Ipswich MA) or ΦX174 RF I DNA (dsDNA substrate ...
-
bioRxiv - Genetics 2023Quote: ... The PCR reaction was performed using NEBNext® High-Fidelity 2× PCR Master Mix (New England BioLabs, catalog #M0541) with a reaction volume of 10 ul including 5 ul 2× PCR Master Mix ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... Homology fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621), while guide RNAs were inserted by ligation using T4 ligase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... or 40,000 nuclei per well in 22 µL of NSB and 2 µL of 10 mM dNTP mix (NEB).