Labshake search
Citations for New England Biolabs :
2301 - 2350 of 2950 citations for 7 Oxabicyclo 4.1.0 heptane 3 carboxylicacid 2 ethylhexyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2019Quote: ... only the cells expressing iRFP-tau WT were treated with 2 U/μL λPP (New England Biolabs # P0753) for 3 hours at 30 °C with gentle rotating ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 µL of NEB Buffer 2 and 15 µL of 25 U/µL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... and an additional hour after the addition of 2 U/ 50 µl of DNase (New England Biolabs, Inc.). The RNA samples were purified using an 8% Acrylamide:Bis-Acrylamide (29:1 ...
-
bioRxiv - Molecular Biology 2020Quote: Biotinylated DNA pellets were re suspended in 25μl TNE0.2 buffer (200mM NaCl, 10mMTris-HCl 7.5, 1mM EDTA) and mixed with 25μl Streptavidin coated magnetic beads (NEB, pre washed in TNE0.2 and blocked with 100μg/ml salmon sperm DNA) ...
-
bioRxiv - Neuroscience 2020Quote: ... A cDNA amplification mixture was prepared by adding 5µl of the resulting first strand cDNA with 7.5µl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5µl water ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Microbiology 2022Quote: ... region between MCS-1/MCS-2 and linearized pETDuet plasmid were ligated using the Gibson Assembly® (NEB) to generate the pETDuet pe15/ppe20 plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each sample was first treated with DNase I (New England Biolabs; 2 μL and 25μL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular plasmid DNA ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and assembled into the backbone vector at a 2:1 molar ratio via Golden Gate Assembly81 (NEB #R3733). The assembly mix was then transformed into electrocompetent DH10B E ...
-
bioRxiv - Genomics 2019Quote: ... The cell lysate was centrifuged for 5min at 2,000g at RT and suspended in 500μl of 1X Restriction buffer 2 (NEB). This step was repeated thrice ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were then stopped by 2 μl of no SDS-purple gel loading dye (New England BioLabs) and separated on 0.6% agarose gel at 100V for 50 min in 1XTBE ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human recombinant histone H2A/H2B dimer (1.5 μg, 54 pmol) and histone (H3/H4)2 tetramer (1.5 μg, 27 pmol) (New England BioLabs) were mixed with the linearised 601 DNA fragments (6 μg ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Ligation was performed on a 2 mL reaction scale with 1X T7 DNA Ligase buffer (New England Biolabs), 4 µM dsDNA adaptor with two different 4 base sticky-ends ...
-
bioRxiv - Genetics 2020Quote: ... and multiplex barcoded with NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2) (NEB, Ipswich, USA). An Illumina MiSeq device (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Genomics 2019Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2) using Q5 polymerase (NEB) and genomic DNA templates obtained from the Liebniz Institute [dsmz.de] ...
-
bioRxiv - Microbiology 2020Quote: The RNA was ligated to 10.7 pmol barcode DNA linker using 200 U T4 RNA ligase 2 (NEB) overnight at 16 °C ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids (Supplementary Table T 2) were cloned by isothermal assembly using NEBuilder HiFi DNA Assembly Mix (NEB). Plasmids were transformed into E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL of each reaction was combined with 2 µL of 6X Purple Gel Loading Dye (NEB B7024S) and 11 µL H2O and run on a 1.2% agarose gel containing 1X GelGreen Nucleic Acid Stain (Biotium 41005 ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The reaction was incubated at 37°C overnight and stopped by adding 2 Units of DNase I (NEB) and incubating at 37°C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...