Labshake search
Citations for New England Biolabs :
2401 - 2450 of 7865 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The sfGFP1-6-CAM-CB5-mRuby3 were inserted using Gibson assembly (NEB E2611). The insert was amplified with the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Microbiology 2019Quote: ... the 11.4 kb fragments of GPV- or HIV- GPP were joined with their cognate 304 bp zip coded partial U3 inserts via Gibson Assembly in a molar ratio of 1:5 per reaction using HiFi DNA assembly mix (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... solution was diluted 1:20 and 5 μL used in a standard 50 μL PCR reaction using Q5 enzyme (NEB). PCR products were Sanger sequenced and analyzed using SnapGene to identify SNP corrected clones (7/192) ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... The hygR insert and the inverse PCR product of the pEX18Ap backbone were mixed at a 5:1 ratio and ligated for 30 minutes at 50°C with New England Biolabs (NEB) Gibson Assembly ® Cloning Kit to create pEX18HygB ...
-
bioRxiv - Genomics 2022Quote: ... The TdT reation was prepared using 4 μL of the resulting elutant and 5 μL of ice-cold TdT mix (standard Quartz-seq2 condition: 1× Thermopol buffer [New England Biolabs] ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The vector and insert DNA fragments were assembled in a ratio of 1:5 using NEBuilder HiFi DNA Assembly (E5520S, New England Biolabs). The gl2L480P ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-5 uL of the cDNA product was PCRed with Phusion Hot Start Flex DNA Polymerase (New England BioLabs, M0535S), using a barcoded version of SGR-176 and a version of the 10x Genomics cDNA primer that included a P5 addition ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5–1 μg of circFL-seq cDNA was repaired and dA-tailed by the NEBNext FFPE DNA Repair Mix (NEB) and NEBNext Ultra II End repair/dA-tailing Module (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription was initiated upon addition of 4 nM of dsDNA template (gblocks Gene Fragment, IDT) to a solution of 5 U.μL-1 of T7 RNA polymerase (NEB, M0251), 1 U.μL-1 of murine RNase Inhibitor (NEB M0314) ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysates were incubated with 0.9 mM MnCl2 and 7 U/μl lysate lambda protein phosphatase (λPP; New England BioLabs), or 0.9 mM MnCl2 and H2O as control ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA of RIN (RNA integrity number) more than 7 is subject to NEBNext Small RNA library kit (NEB). After final PCR amplification with indexed-adaptors ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Taq I-digested chromatin was diluted 7-fold to which 10,000 cohesive end units of Quick T4 DNA ligase (New England Biolabs) were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were generated by 7 rounds of PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genomics 2024Quote: ... 30 µL of the eluted DNA samples were mixed with 7 µL of TSO digestion mix (3.5 µL UDG-DNA glycosylase and 3.5 µL UDG Buffer, NEB M0280S) and incubated at 37 ºC for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... asynchronous or mitotic HeLa cell lysates were incubated with 0.9 mM MnCl2 and 7 U/µl λPP (New England Biolabs) or 0.9 mM MnCl2 and water for 1 h at 30 °C.
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2’O-methylated using Vaccinia VP39 (2’O Methyltransferase) (New England Biolabs), then purified by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...