Labshake search
Citations for New England Biolabs :
2301 - 2350 of 7865 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were multiplexed with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB). Size selection steps were performed with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM CaCl2 and the indicated volumes of 2 units bovine pancreatic DNase I (New England Biolabs) were added for the indicated incubation times at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... vaccinia mRNA 2’-O-methyltransferase (NEB, 250 U every 2 h) and water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sets used were designed by Primer 6 (PREMIER Biosoft Biolabs) (Appendix Table S2) ...
-
bioRxiv - Biochemistry 2019Quote: ... unlabeled AdoMet was left out and 6 μg of MBP2* protein (NEB) was added to each reaction to increase molecular crowding.
-
bioRxiv - Microbiology 2022Quote: ... the reactions were stopped by adding 2µl of 6× loading dye (NEB) containing 20 mM EDTA and analyzed via agarose gel electrophoresis.
-
bioRxiv - Evolutionary Biology 2020Quote: ... SgRNAs were complexed to 6 μg EnGen Spy Cas9-NLS (NEB #M0646) in an approximately 1:1 molar ratio for 15 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... The extract was bound to 6 ml amylose resin (New England Biolabs) for 1 h batchwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S), and NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL T4 PNK (NEB), and 1 µL Klenow large fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL CutSmart buffer (NEB), and 30 μL of nuclease-free water and incubated for 1 h at 37 °C and 10 min at 80 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL HinFI enzyme (NEB), 5 μL ExoI buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL ExoI buffer (NEB), 5 μL CutSmart buffer (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... and SacII (NEB, Figure 5) overnight at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... and 5-mdCTP (NEB #N0365S)) similar to T-WGBS (Lu et al ...
-
bioRxiv - Genetics 2021Quote: ... RNAse H (5 Units, NEB), rSAP (1 Unit ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl CviQI (NEB R0639S), and 5 μl CviAII (NEB R0640S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25U 5’ Deadenylase (NEB, #M0331S), 30U RecJ endonuclease (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli NEB 5-alpha (NEB) and plated onto medium with the cognate antibiotic ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 U T4 ligase (NEB), and water for a total reaction volume of 20 μl ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5’ dephosphorylation protocol (NEB #M0289) and T4 DNA ligase protocol (NEB #M0202) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl HinFI (NEB, R0155S), 5 μl ExoI buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5μl 5’ Deadenylase (NEB M0331S), 1μl RecJ endonuclease (NEB M0264S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli 5-alpha cells (NEB). Plasmid DNA from multiple independent clones was isolated for each construct using a Zymo Zyppy 96-well plasmid prep kit ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 ng ET SSB (NEB), 4 nM phi29 DNAP in a 100 μl reaction and incubated for 3 h at 30°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μL rCutSmart Buffer (NEB), and 1 μL DpnI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB) 0.5 nL BSA (20ng/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB), 1.2 nL BSA 20 ng/ml (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... coli 5-alpha cells (NEB) following manufacturer’s recommendations and selected by plating on LB in the presence of appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL RppH (NEB #M0356S). Decapped RNA was cleaned using Zymo Oligo clean and concentrator kit (Zymo Research #D0460 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-deadenylase (NEB M0331S) treatments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5’ deadenylase (NEB, M0331) for 30min at 30°C followed by column purification (Zymo research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB, R0539L) and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) and otherwise followed the manufacturers recommended protocol ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), 4.13 µL of H2O ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB), 250 U T4 DNA ligase (2,000,000 U/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-decapping (RppH, M0356S; NEB) and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB 5-alpha (NEB) cells stored at −80 °C were thawed on ice and transformed with the ligation mixture according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...