Labshake search
Citations for New England Biolabs :
2351 - 2400 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... A standard PCR was performed using Taq DNA polymerase in ThermoPol buffer (NEB) at an annealing temperature of 60°C and elongation temperature of 68°C ...
-
bioRxiv - Biophysics 2019Quote: ... PCRs were performed using these primers and Phusion High-Fidelity DNA polymerase (NEB). PCR products were gel-purified and µg of DNA material was added to 1 µl Anza™T4 DNA Ligase Master Mix (ThermoFischer ...
-
bioRxiv - Molecular Biology 2021Quote: ... then ligated with the phosphorylated PCR fragments by T4 DNA Ligase (NEB, M0202S). Inserts were analyzed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR amplification steps used the high fidelity Q5 Polymerase (New England Biolabs) and primers from Integrated DNA Technology (Coralville ...
-
bioRxiv - Biochemistry 2020Quote: PCR was performed using Phusion HF polymerase purchased from New England Biolabs (NEB). T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR amplicons were subjected to restriction digestion using BsaXI (New England Biolabs) for 60 minutes at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR was performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs), temperatures were as follows ...
-
bioRxiv - Immunology 2020Quote: ... and enrichment PCR performed with NEBNext Ultra Q5 Master Mix (New England BioLabs). Samples were pooled in equal proportions and size-selected using 0.6x then 0.2x AMPure beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2019Quote: ... and the GFP PCR was digested with AatII and BglII (New England Biolabs). The two fragments were then ligated together (via the AatII digest site ...
-
bioRxiv - Genetics 2019Quote: ... PCR was performed with Phusion® High-Fidelity DNA Polymerase (New England Biolabs) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Each 100 μl PCR reaction contained 1x Phusion HF reaction Buffer (NEB, #B0518S), 3% v/v DMSO ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were digested with 20 units of XmnI and XcmI respectively (NEB) to distinguish cleavable mutant from un-cleavable wild-type amplicons ...
-
bioRxiv - Genomics 2021Quote: ... Three-primer PCR reactions were performed with OneTaq DNA Polymerase (New England Biolabs) in a 25 µl reaction ...
-
bioRxiv - Genomics 2021Quote: ... the PCR reactions were treated with 200 U/ml of Exonuclease I (NEB) for 1 h at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... Mutagenesis PCR product was then digested overnight using DpnI (New England Biolabs, R0176) followed by bacterial transformation into competent cells ...
-
bioRxiv - Genetics 2021Quote: ... PCR was limited to 18 cycles using Phusion polymerase (New England Biolabs, M0530). Mutagenesis PCR product was then digested overnight using DpnI (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... Gel-purified PCR products were A-tailed using Taq polymerase (New England Biolabs) for 30 min at 72 °C ...
-
bioRxiv - Genomics 2021Quote: ... the PCR reactions were treated with 200 U/mL of Exonuclease I (NEB) for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and assembled into PCR amplified pFastBac vector by NEBuilder HiFi DNA assembly (NEB). CAMSAP2 mutant constructs were generated by inserting each mouse CAMSAP2 partial PCR fragment flanked by a TEV protease recognition linker (ENLYFQGSSGSSG ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were carried out using Q5 High-Fidelity polymerase (New England Biolabs) and oligomers used for amplifications listed in Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... the sequence encoding SNAP-tag was PCR amplified from pSNAPf (New England BioLabs) with primers to append flanking BamHI and NotI restriction sites (Forward ...
-
bioRxiv - Physiology 2021Quote: ... Mutations in hSlo1 and β1/4 were introduced by PCR-mediated mutagenesis (NEB) using oligonucleotide primers (IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... The qRT-PCR assay was performed using Luna Universal qPCR Master Mix (NEB) with a total volume of 20 µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... site directed mutagenesis experiments were performed with standard PCR-based methods (NEB, #E0554S) using corresponding primer sets:
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... the PCR products were further digested with NcoI (New England Biolabs, Cat# R3193S) at 37°C for 1 h and then ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext Hi-Fi 2x PCR Master Mix (NEB (Ipswich, MA, USA) M0541S) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCRs were performed using Q5® High-Fidelity 2X Master Mix (NEB #M0492L), sfGfp as the template ...
-
bioRxiv - Immunology 2021Quote: ... The RBD-6his coding sequence was amplified by PCR using PHUSION polymerase (NEB) and TAAACTTAAGACAACCATGGTCGTGTTTCTGGTGC as a forward primer and GGGGATCCcGTCTTCCTCGAGTTATCAATGGTGATGGTGA as reverse primer ...
-
bioRxiv - Bioengineering 2021Quote: ... fumigatus was amplified by PCR using the Q5 DNA Polymerase (New England Biolabs), the primers pyrG_fwd-AflII-NsiI and pyrG_rev-EcoRI-AatII ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplicons were generated using Q5® High-Fidelity 2X Master Mix (NEB) using primers PKS12_F2 and PKS12_R2 ...
-
bioRxiv - Microbiology 2020Quote: ... except the second step of joint PCR using Taq enzyme (New England Biolabs) (Yu ...
-
bioRxiv - Microbiology 2020Quote: ... The linearized PCR product was dephosphorylated using Shrimp Alkaline phosphatase (New England Biolabs) per the manufacturer’s instructions and then ligated with tetL to generate the deletion construct PB408 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR reaction was performed with Q5 High-Fidelity Polymerase Master Mix (NEB) and the product column purified with a QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Hemi-nested PCR was performed with Taq DNA Polymerase (NEB, Ipswich, MA, USA). First round PCRs were performed with 5μL of cDNA ...
-
bioRxiv - Microbiology 2021Quote: Amplification was performed by PCR using Q5 Hot Start polymerase (New England Biolabs) with total final primer concentration of 3.5 μM (individual primer concentrations varied depending on how many primers were pooled. ...
-
bioRxiv - Immunology 2020Quote: ... PCR was performed using Phusion Hot Start Flex DNA Polymerase (New England Biolabs).
-
bioRxiv - Immunology 2021Quote: ... followed by PCR amplification with NEBNext UltraII Q5 Master Mix (New England BioLabs). Libraries were subjected to Illumina deep sequencing (HiSeqV4 SR50) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR reactions were performed with Taq 2X Master Mix (New England BioLabs, M0270L). The thermocycler conditions for Mouse Chk1 and GAPDH PCR product were as follows ...
-
bioRxiv - Genomics 2021Quote: ... and 25 μL of 2X PCR mix with Q5 DNA polymerase (NEB #M0491S) (Q5 5X buffer ...
-
bioRxiv - Genomics 2021Quote: ... and amplified using NEBNext High-Fidelity 2x PCR MasterMix (New England BioLabs M0541) with the Nextera primer Ad1 (1.25 µM ...
-
bioRxiv - Genomics 2020Quote: ... Pooled PCR products were subjected to 1U/μl Not1 HF (New England BioLabs) endonuclease digestion at 37°C for one hour ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA (20 ng) was PCR amplified using LongAmpTaq 2X master mix (NEB). The PCR amplicons of selected regions were subjected to Sanger sequencing and BLAST analysis to confirm the presence of eight variants using the primers listed in Supplemental Table 1.
-
bioRxiv - Genetics 2020Quote: ... PCR amplification was performed using Phusion High Fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Genetics 2020Quote: ... we prepared PCRs in final 25 μl volumes consisting of 1× buffer (NEB Hot Start Taq® 2X Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... all PCRs were performed using the high-fidelity Phusion DNA polymerase (NEB, USA) and custom-made primers ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA and PCR amplicons were digested with commercial restriction enzymes (NEB, USA); DNAs were ligated using T4 DNA ligase (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... HiC DNA was amplified using PE PCR primers and Phusion DNA polymerase (NEB) for 7-9 cycles ...
-
bioRxiv - Microbiology 2022Quote: Phusion High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs #M0530) was used to amplify cDNA around the region of interest ...
-
bioRxiv - Microbiology 2022Quote: ... the homology regions were amplified by PCR (NEB, Q5 high-fidelity DNA polymerase) from wildtype genomic DNA of CBS7435 used before15 ...
-
bioRxiv - Microbiology 2022Quote: ... for PCR amplification and the Gibson Assembly Master Mix (New England Biolabs, NEB) according to the manufacturer instructions ...