Labshake search
Citations for New England Biolabs :
2301 - 2350 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 of α2-3,6,8,9 Neuraminidase A (New England Biolabs, Fig. 2d and Extended Data Fig. 2a,b) were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were cooled and then digested with DpnII for one hour at 37° C (NEB, R0543). These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′ ...
-
bioRxiv - Developmental Biology 2021Quote: ... The guide RNA was injected into one-cell stage embryos together with Cas9 protein (N.E. Biolabs). Mutant animals were identified by PCR using the following primers ...
-
bioRxiv - Genomics 2019Quote: ... and ligated to indexed P1 adapters (one index per sample) using concentrated T4 DNA ligase (NEB). Ligated DNA was purified using AMPure XP magnetic beads ...
-
bioRxiv - Systems Biology 2019Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs). 1 μl of 10-fold diluted RNA was added to 4 μl of rtPCR mix and subjected to a reverse transcription step at 55°C and 45 cycles of PCR (10 seconds at 95°C and 30 seconds at 60°C) ...
-
bioRxiv - Systems Biology 2019Quote: ... one-third of the DNA sample was amplified using Illumina indexing primers (NEB Catalog no. 7600L). PCR product was size selected by running on 1.5% agarose gel ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... SYBR green based RT-qPCRs were performed using Luna Universal One-Step RT-qPCR Kit (NEB).
-
bioRxiv - Genomics 2020Quote: ... One µL of the cDNA was then mixed with Luna qPCR master mix (New England Biolabs) and primers (to a final concentration 100 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs). Primers targeting the MS2 stem-loop regions were used for quantifying repeat RNA expression levels ...
-
bioRxiv - Immunology 2020Quote: ... Real time qPCR was performed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pathology 2022Quote: ... qRT-PCR analysis was carried out using the Luna Universal One-Step RT-qPCR kit (NEB) using 100 ng RNA as input according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... A-overhangs were added to Phusion products with one unit Taq polymerase (New England Biolabs; MO267S) followed by 10 min incubation at 72°C ...
-
bioRxiv - Genomics 2019Quote: ... samples were cooled and then digested with DpnII for one hour at 37°C (NEB, R0543). These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′ ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... One microgram (1ug) of PCR was digested with 1ul of EcoR I-HF (New England Biolabs) and 1ul Hind III-HF (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... the uridines present in one cDNA strand were digested with uracil- N-glycosylase (New England BioLabs), as described 67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression was determined using SYBR green Luna One Step RT-qPCR Kit (New England BioLabs) on a C1000 Touch (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: One μg of RNA was reverse transcribed using the LunaScript RT SuperMix Kit (New England Biolabs) according to the manual ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the modifications (gRNA and complementary sequences) were introduced in one step using Q5 mutagenesis (NEB) and was placed in the MoClo pICH86988 acceptor with a 35S promoter ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was reverse-transcribed and PCR amplified using Luna Universal One-Step RT-PCR Kit (NEB). SARS-CoV-2 replication was assessed by using primers specific to the N mRNA (Forward 5’-CTCTTGTAGATCTGTTCTCTAAACGAAC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... One round of m6A immunoprecipitation was performed using the EpiMark N6-Methyladenosine Enrichment Kit (NEB #E1610S) and protocol ...
-
bioRxiv - Immunology 2023Quote: Reverse transcriptase qPCR was performed using Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006L). The following predesigned primers and probe sets for each target and the housekeeping gene GAPDH were purchased from IDT:
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed using the OneTaq One-Step RT-PCR Kit (New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to manufacturer’s instruction on an iQ5 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed by using Luna Universal One-Step RT-qPCR reagents (New England Biolabs), following the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: The all-in-one constructs (e.g., pRDA_917) were digested with BsmBI-v2 (New England Biolabs #R0739S) for two hours at 55°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The four TALEN expression vectors encoding one of four possible RVDs were linearised with BsmBI (NEB). The biotinylated α unit fragments were ligated to the first βγδε fragments using Quick T4 DNA ligase and bound to Dynabeads MyOne C1 streptavidin-coated magnetic beads (Life Technologies) ...
-
bioRxiv - Developmental Biology 2024Quote: ... after which the library amplification was one with Phusion High-Fidelity DNA Polymerase (New England Biolabs) during which the Illumina adapters were introduced ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was then performed using Luna Universal One-step RT-qPCR kit (New England Biolabs) following the provided protocol on a BioRad CFX Opus 96 quantitative Real-Time PCR machine ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of DNase I (2 U/μl, New England Biolabs) to 30 μl RNA product ...
-
bioRxiv - Developmental Biology 2023Quote: Rehydrated embryos were blocked for 2 hs in 2% BSA (B9000, NEB) in PBS with 0.3% Triton X-100 (T9284 Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...