Labshake search
Citations for New England Biolabs :
2551 - 2600 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2’O-methylated using Vaccinia VP39 (2’O Methyltransferase) (New England Biolabs), then purified by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Genomics 2020Quote: ... One microgram of the sonicated DNA was incubated in 1x T4 DNA ligase buffer (NEB; Ipswich, MA) with components ...
-
bioRxiv - Microbiology 2019Quote: ... we performed q-RT PCR using the Luna Universal One-Step RT-qPCR Kit from NEB (E3005), using the Applied BiosystemsΤΜ 7500 Real-Time PCR system ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All Gibson reactions were performed at 50 °C for one hour with T5 exonuclease (New England Biolabs), Phusion polymerase and Taq ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed in a 50 µl reaction mixture with One Taq 2x master mix (NEB), 20 ng of cDNA and 0.2 µM of each primer (Sigma) ...
-
bioRxiv - Genomics 2021Quote: One reaction of NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645) was used for 1 μg of input DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... One microgram of total RNA was reverse transcribed into cDNA with Protoscript II (New England Biolabs, M0368L) followed by qPCR with SYBR Green Master Mix (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... The amplified PCR product was digested in one step using NdeI and BamHI HF (New England Biolabs) and ligated into similarly treated pET-15b to create plasmid pET15b-EcGhrA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... One μg of RNA was used to prepare cDNA using the LunaScript RT SuperMix (New England Biolabs). cDNA was then diluted 10-fold and 1 μL was used per qRT-PCR reaction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and IFIH1 were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... one PCR product amplified from gBlock1 (JEP1862+JEP1863) and pMS26 digested with NotI using NEBuilder Hifi (NEB). pMTP114 was constructed by assembling two PCR products amplified from F plasmid (JEP1398+1340 and JEP1341+1399 ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 12.5 µl of One Taq Quick-load 2x master mix with standard buffer (New England BioLabs, UK) was aliquoted into a DNase-free 0.2ml transparent PCR tube ...
-
bioRxiv - Microbiology 2022Quote: pJJW101 derivatives containing one of the four NT ospA-targeting sgRNAs were cut with BglI (NEB, R0143), dephosphorylated with Quick-CIP (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... annealed into double stranded sgRNA oligos and cloned into LentiCRISPRv2 plasmid using one step BsmBI (NEB #R0580) digestion and T4 ligase (NEB #M0202S ...
-
bioRxiv - Microbiology 2023Quote: ... Transcript levels of individual genes were determined by the Luna Universal One-Step RT-PCR kit (NEB) using approximately 100-200 ng of total RNA per sample as input ...
-
bioRxiv - Molecular Biology 2023Quote: ... All qRT-PCR reactions were performed with the Luna Universal One-Step RT-qPCR kit (E3005 NEB) according to manufacturer protocol with a few modifications ...
-
bioRxiv - Immunology 2023Quote: ... expression levels were determined using the Luna Universal One-Step RTqPCR kit (New England Biolabs catalog #E3005X) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and RpoD control were assessed using the Luna Universal One-Step qRT-PCR kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... thermocycler with the Luna Universal one-step qPCR Master Mix (E3005; New England Biolabs, Ispwich, MA, USA). Amplification reactions for genes of interest were performed in 50 cycles of the following cycling protocol ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Microbiology 2023Quote: We performed RT-qPCR on select genes using the Luna Universal One-Step Kit (New England Biolabs) and QuantStudio 5 (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... each gDNA sample was divided into two and one aliquot was digested with StyI-HF (NEB, R3500S). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng of total RNA was used with Luna Universal One-Step RT-qPCR (NEB, Ipswich, MA) to detect StayGold mRNA expression ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...