Labshake search
Citations for New England Biolabs :
2301 - 2350 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL 10X rCutSmart buffer (NEB, B6004S), and H2O to 10 μL incubated at 37°C for 2 hours and 80°C for 1 hour) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1 μL Taq polymerase (NEB, M0267S) and incubation at 37°C for 20 min and 72°C for 5 min) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 μL T4 ligase buffer (NEB, B0202S), 0.5 μL Esp3I (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and with 1 µL PmeI (NEB #R0560). If plasmid concentration was not sufficient ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL T4 DNA Ligase Buffer (NEB), and water to 10 µL was incubated at 37°C for 1 hour ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1 U/µL murine RNAse inhibitor (NEB), 400 nM 11S NanoLuc protein (purified as described in25) ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... the EcoRI inverse PCR yielded a desired length of 2 kb of promoter sequence but for duck and quail less than 2 kb of the promoter was initially sequenced so inverse PCR was repeated using XbaI (R0145S, NEB, Ipswich, MA, USA).
-
bioRxiv - Immunology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA). The expression of each transcript was calculated according to the transcripts per million reads method ...
-
bioRxiv - Molecular Biology 2021Quote: Variants of concern (VOC) of SARS-CoV-2 were created with Q5® Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ phosphate-containing rsmY and rsmZ amplicons were then ligated to the linearized dephosphorylated L4440 vector using a 2-hour room temperature incubation with T4 DNA ligase (NEB Cat. No. M0202S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Genomics 2023Quote: LIDAR and 3’-LIDAR libraries were analyzed on a 2% agarose gel and quantified using NEBNext Library Quant Kit for Illumina (New England Biolabs, Cat. No E7630L). Libraries were sequenced on an Illumina NextSeq500.
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Cell Biology 2024Quote: ... and treated for 10 min at RT by RNase III enzyme (2 U of RNase III (Short Cut, New England BioLabs, Massachusetts, USA, M0245S) with 20 mM MnCl2 in 1× reaction ShortCut buffer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids cleavage was conducted at 37 °C for 10 min and stopped by addition of 2×RNA loading dye (New England Biolabs, Ipswich, MA, USA). Before loading ...
-
bioRxiv - Microbiology 2022Quote: CRISPR-Cas12a reactions were carried out in 20 μL reaction volumes with 2 μL NEBuffer™ r2.1 (New England Biolabs, Ipswich, Massachusetts, USA), 500 nM crRNA ...
-
bioRxiv - Genomics 2022Quote: ... and the results (Figure 2) suggested that a combination of the rare cutter HindIII and the frequent cutter Sau3AI (New England Biolabs, NEB, Ipswich, MA) would provide restriction fragments suitable for ddRAD-Seq (150-700 bp).
-
bioRxiv - Microbiology 2024Quote: Reverse transcription was carried out with 8 μl of total nucleic acid added to 2 μl of NEB Lunascript RT Supermix (New England Biolabs Cat no. E3010). Nuclease free water was used as a no template control (NTC ...
-
bioRxiv - Plant Biology 2024Quote: ... The correct sequence was introduced into the destination vectors pCAMBIA1300-2× 35S [enhanced cauliflower mosaic virus (CaMV) 35S promoter] at the restriction enzyme sites BamHI and PstI (New England BioLabs, Ipswich, MA, USA). The sgRNAs were designed through CRISPR-P 2.0 (http://crispr.hzau.edu.cn/cgi-bin/CRISPR2/SCORE ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... was utilized using 1 µg gDNA and the pre-annealed NEB adapter (NEB_P7, NEB_P5, 15 µM; Supplementary Table 1). The manufacturer’s instruction was followed without performing the USER enzyme step ...
-
bioRxiv - Genomics 2024Quote: ... beads were resuspended in 1 ml binding buffer (as described above) including 1 μl of fusion enzyme Nt.CviPII-pGL (NEB) for 1 hr at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 8.0) for 1 h at 37 °C and washes in CSTX buffer (1× CutSmart buffer (New England Biolabs (NEB) B60004) ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 mM dNTPs (NEB #N0447L), 250 nM PAGE-purified forward and reverse primers ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 U Turbo DNase (NEB) and 3 U FastAP enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...