Labshake search
Citations for New England Biolabs :
2251 - 2300 of 7433 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out with 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs); 0.2 μM each of forward and reverse primers ...
-
bioRxiv - Microbiology 2020Quote: ... Eluted cDNA was transferred to a new PCR tube containing 15 μL of 2X Phusion HF-PCR Master Mix (NEB), 0.5 μL of 30 μM P3/P6 PCR1 oligo mix and 0.5 μl of 15x SYBR Green I (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: DNA probes were synthesized via PCR with Q5 high-fidelity polymerase (Thermo) and purified with Monarch PCR Cleanup Kit (NEB). 75ng probe A/probe B and 150ng probe C/probe D were added to increasing concentrations of protein (4% ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... The resulting PCR products were used in a PCR to add Gateway attB sites: 25 µL Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB), 1 µL PCR product ...
-
bioRxiv - Immunology 2022Quote: All CER constructs were generated by standard PCR cloning techniques and the PCR products were assembled using the NEBuilder HiFi DNA Assembly (New England Biolabs). CER21 was generated by linking the extracellular and transmembrane domain of human TIM-4 (GenBank™ accession number AAH08988.1 ...
-
bioRxiv - Cell Biology 2022Quote: ... an 887bp portion of mtDNA containing nd-1 was amplified by PCR and TA-cloned into pMiniT2.0 using the NEB PCR cloning kit (NEB E1202S). Purified plasmid was linearized with BamHI-HF (NEB 3136) ...
-
bioRxiv - Genetics 2019Quote: ... and joined in a single step by overlap extension PCR (1st step: equimolar mix of PCR fragments ZEO, HR and HL, NEB Q5 high-fidelity 2X master mix ...
-
bioRxiv - Immunology 2019Quote: ... TCR amplification was achieved by performing two rounds of nested PCR using Phusion High-Fidelity PCR Master Mix (New England Biolabs). During the first PCR priming ...
-
bioRxiv - Genomics 2019Quote: ... 128 ng of this mixture was used per PCR with NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) along with the reverse-transcriptase primer (Creb_Hand_RT ...
-
bioRxiv - Genomics 2019Quote: ... This volume was distributed across 14 replicates per technical replicate so as to not exceed 10% of the total PCR volume and amplified using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) with the primers P5_Seq_Luc_F and P7_Ind_##_Han ...
-
bioRxiv - Developmental Biology 2020Quote: ... We tested all primers using 1uL of genomic DNA from H9 human ES cells in a PCR reaction containing 12.5 uL Phusion High Fidelity PCR Master Mix (NEB, M0531L), 1.25 uL 5 uM forward primer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ sequences were amplified from WT adult gDNA extracted using the NucleoSpin Tissue Kit (Machery-Nagel) by PCR using Phusion High Fidelity PCR Master Mix (NEB) and primers 5’-ttttgcggccgcTCTGTTTGAATATGTTTCCGAGAA −3’ and 5’-ttttctcgagTTTCCGCGACAAAAACACAGA-3’ which add restriction enzyme recognition sites NotI and XhoI ...
-
bioRxiv - Biophysics 2020Quote: ... The construct encoding for the EC2 domain of CD9 (CD9EC2, residues K114 – N191) was generated with a PCR reaction using the Q5-PCR kit (NEB). The CD9EC2 construct was cloned in a pUPE expression vector with a N-terminal cystatin signal peptide and a C-terminal 6x-His tag ...
-
bioRxiv - Cell Biology 2021Quote: Site-directed mutagenesis of pLenti-CMV-Neo-PINK1 (C125G)-EYFP or pLVX-puro-OMA1 (E328Q)-EYFP was performed by PCR amplification (CloneAmp HiFi PCR Premix, Takara or Q5 High-Fidelity DNA Polymerase system, NEB) of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system ...
-
bioRxiv - Cell Biology 2021Quote: ... 319 bp and 201 for the heterozygous vclb mutants and PCR products of 490 bp and 319 bp for homozygous vclb mutants PCR was performed using OneTaq DNA polymerase (NEB) and PCR products were loaded on a 1% agarose gel to assess the genotype (see Supplementary Figure 2).
-
bioRxiv - Genomics 2021Quote: ... was amplified and barcoded in parallel using the same PCR program in 50 μL PCR reaction (2 μL gap-repaired DNA, 25 μL 2× NEBNext High-Fidelity PCR Master Mix (NEB), 1.5 μL 10 μM i5 universal PCR primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 200-275 base pair region containing the relevant sgRNA target sequence was PCR-amplified from genomic DNA using the NEBNext High-Fidelity 2X PCR Master Mix (New England BioLabs) in a 25 µL PCR reaction volume (primer sequences appear below) ...
-
bioRxiv - Bioengineering 2022Quote: ... The PCR products were purified and cleaned using a Monarch® PCR & DNA cleanup kit (New England BioLabs, Ipswich, MA). RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by a single-cycle of PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) (98°C for 10 sec pre-denaturation followed by 98°C for 5 sec ...
-
bioRxiv - Microbiology 2022Quote: ... To perform the qRT PCR we followed the recommendations of the manufacturer Luna Universal One-Step qRT-PCR Kit (New England BioLabs Inc. ...
-
bioRxiv - Genetics 2022Quote: ... DNA of Del1 and Del2 from Family 1 were used to amplify different haplotypic fragments with long-range PCR or TD-PCR (Table S17) adding restriction enzymes (MluI and KpnI, NEB) on the 3’ of primers ...
-
bioRxiv - Synthetic Biology 2024Quote: Desired sequences were amplified using two subsequent PCR reactions using the Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB). All extension steps were carried out in a 15s timeframe and the first PCR round consisted of 10 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were immediately purified using a Qiagen minElute column and subjected to PCR amplification with NEBNext High-Fidelity 2X PCR Master Mix (NEB). Optimal PCR cycles were determined via qPCR to avoid over-amplification ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 µg of purified DNA (PCR product after 2nd round PCR after selections) was incubated with PstI-HF (New England Biolabs) at 37 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... The two flanking regions of the chosen genomic exchange region were amplified and joined with PCR fragment carrying antibiotic resistance cassette by overlapping PCR using Q5 polymerase (New England BioLabs). Next ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 25 uL of 2xphusion PCR mastermix (Phusion High-Fidelity PCR Master Mix with HF Buffer – 100 rxns, NEB, cat #M0531S), 0.625uL of 100uM F primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ligated dsDNA products were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs) with 200 nM of Illumina multiplex and index barcode primers (98°C for 10 sec pre-denaturation followed by 15 cycles of 98°C for 5 sec ...
-
bioRxiv - Genomics 2023Quote: ... 10µL of transposed DNA was amplified in a 50µL PCR reaction using NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs, M0541S) for 5 cycles after a 5 min elongation step ...
-
bioRxiv - Developmental Biology 2023Quote: Five PCR reactions of 50 μl PCR mixture were made and amplified using Q5 High-Fidelity DNA polymerase (M0491; NEB). Next ...
-
bioRxiv - Genetics 2023Quote: ... 50 µl PCR reactions were performed for each timepoint using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with 20 to 50ng of template isolated plasmid DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... from which a 500 bp dsDNA containing the λC31 attB at its center was generated by PCR using Phusion High Fidelity PCR Master Mix from NEB. After heat denaturation ...
-
bioRxiv - Biochemistry 2022Quote: ... or mutants W79F and I176F were obtained by the overhang PCR or by the megaprimer PCR method respectively using Q5 (NEB) polymerase ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA cassette was PCR amplified from genomic DNA using Phusion High-Fidelity PCR Master Mix (New England Biolabs, M0531S). The amplified products were pooled and amplified again via PCR using primers harboring Illumina TruSeq adapters with i5 and i7 barcodes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and sgRNA cassettes were amplified using 22 cycles of PCR using NEBNext Ultra II Q5 PCR MasterMix (New England Biolabs). Sequencing was performed on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... eluted in 20 µl of water and PCR amplified using 25Lμl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541LL), 2.5Lμl of each i5 and i7 Illumina index adapter (IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... Vector and insert fragments were amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF buffer from New England Biolabs (NEB). The fragments were analyzed by agarose gel electrophoresis and template DNA was digested using DpnI ...
-
bioRxiv - Bioengineering 2023Quote: ... genomic loci were amplified in a first PCR reaction (PCR-1) reaction from approximately 100 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers listed in Sup ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs) and the following primers:
-
bioRxiv - Immunology 2024Quote: ... sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG ...
-
bioRxiv - Microbiology 2024Quote: ... The first-strand cDNA was then amplified in a PCR reaction with Phusion High Fidelity PCR Master Mix (New England Biolabs) using BRBV segment-specific primers targeting the segment termini ...
-
bioRxiv - Microbiology 2024Quote: ... according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB). Library molarity was measured with the Qubit DNAds HS assay kit from Invitrogen and the quality was analyzed using Bioanalyzer DNA Analysis kit (Agilent ...