Labshake search
Citations for New England Biolabs :
2051 - 2100 of 6951 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Tagmentation reactions were completely used as input for a first PCR reaction with cassette-and Tn5-adapter-specific primers (5Btn-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 15 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Cell Biology 2020Quote: ... These beads were then used as input of a second PCR with cassette-and Tn5-adapter-specific primers (P7-gri701…706-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 25 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA samples incubated for primer extension as described previously were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagmented samples were amplified by the addition of 2.5μL each of 10μM barcoded forward and reverse primers (Picelli et al., 2014) and 15μL Q5 2x HiFI MasterMix (New England Biolabs) using the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using pBluescript SK+ CPES_V5 clone as template with appropriate sense and antisense primers (Table S1) and Phusion polymerase (NEB). The PCR product was digested with DpnI to remove templates followed by transformation into DH5α competent cells ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutants were created via side directed mutagenesis using primers designed on NEBaseChanger and Q5 site-directed mutagenesis kit following manufacturer’s directions (New England BioLabs). BL21(DE3 ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using pBluescript SK+ CPES_V5 clone as template with appropriate sense and antisense primers (Table S1) and Phusion polymerase (NEB). The PCR product was digested with DpnI to remove templates followed by transformation into DH5α competent cells ...
-
bioRxiv - Biophysics 2022Quote: ... The two primers are annealed and the single strand overhangs are filled in using One-Taq DNA polymerase (NEB). These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB ...
-
bioRxiv - Plant Biology 2022Quote: ... each well containing 0.8 µL Primer Master Mix (0.225% Triton X-100, 1.6 mM dNTP mix, 1.875 uM barcoded oligo[dT] CEL-seq2 primers; Sigma-Aldrich, New England Biolabs) using a BioSorter (Union BioMetrica ...
-
bioRxiv - Systems Biology 2019Quote: ... The DNA samples incubated for primer extension as described previously were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: ... 10 pmoles of forward and universal reverse primers were annealed and extended with Q5 high-fidelity DNA polymerase (NEB) according to the recommended conditions and with the following program ...
-
bioRxiv - Neuroscience 2019Quote: Enhancers were cloned from C57Bl/6J genomic DNA using enhancer-specific primers and Phusion high-fidelity polymerase (M0530S; NEB). Individual enhancers were then inserted into an rAAV or scAAV backbone that contained a minimal beta-globin promoter ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and indexed with NEBNext® Multiplex Oligos for Illumina® (96 Index Primers) (New England Biolabs, Ipswich, Massachusetts, USA). Sample libraries at 1.1 pM were sequenced twice on the NextSeq500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Site-directed mutagenesis primers were designed using NEBasechanger and implemented through Q5® Site-Directed Mutagenesis (NEB, Cat #E0554S). TPL interactor genes were amplified as cDNAs from wild type Col-0 RNA using reverse transcriptase (SuperScript™ IV Reverse Transcriptase ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs. Cat. No.: E0554S). The mutations were confirmed by DNA sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... was constructed by assembling two fragments amplified from pON106 using two primer pairs (NeoRH1 and P5_A5_reverse, P5_A5_forward and NeoRH2) with Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). Plasmid No ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was first linearly pre-amplified with 10 nM final concentration 5p-CCR5_UMI primer using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The libraries were amplified and both the indexed and universal primer (NEBNext Multiplex Oligos for Illumina, New England Biolabs) were added by PCR using HGS Diamond Taq DNA polymerase (Eurogentec) ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Immunology 2020Quote: ... Ighγ1 heavy-chain sequences were amplified in a nested PCR using primers for the Ighγ1 constant region together with a specific primer for VH186.2 (Mayer et al., 2017)(Table S1) and using high-fidelity Q5 polymerase (NEB). Amplified products were cloned (CloneJET PCR Cloning Kit ...
-
bioRxiv - Genetics 2020Quote: ... PCR to amplify the barcode for Illumina sequencing was performed on 2.5 µL of isolated DNA (primers listed in Table S1) with Q5 polymerase (NEB), following manufacturer’s instructions with between 25-35 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... ICL3 and S305A mutations were generated using back-to-back primers on pCDNA3.1-HCAR1-Flag vector by Q5 Site-Directed Mutagenesis Kit (NEB). Fluorogen activating peptide fusion to HCAR1 was synthesized with insertion of HCAR1 using BsmI site into pMFAP-β1 vector (Spectragenetics) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... containing the T7 promoter and terminator were amplified using the specific primers (0.25 μM or 0.5 μM) and Phusion® DNA polymerase (NEB). The amplification program was ...
-
Deletion of MEC1 suppresses replicative senescence of the cdc13-2 mutant in Saccharomyces cerevisiaebioRxiv - Molecular Biology 2023Quote: ... 2017) using primers designed by NEBaseChanger and the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, cat. no.: E0554S). The mutations were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2023Quote: ... The primers JA02 GenoF1 (ACAGACGGTTGTTATATTTTGCTCT) and JA02 LOA GenoR (ACTGACTTAATGAATGTCTGACGG) amplicons were digested with (AleI-v2, New England Biolabs). Chil4KD/KD animals have an undigested 405bp band and wild-type animals showing two bands cleaved around 150bp and 250bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... the product was purified using magnetic SPRI beads and amplified using 0.5 µM i5/i7 Illumina indexed primers in Q5 High-Fidelity Master Mix (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were constructed and amplified using 1.25 μM Nextera index primers and NEBNext High-Fidelity 2xPCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Genomics 2022Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) following the manufacturer’s description (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Systems Biology 2023Quote: ... A pcDNA3.4 backbone was amplified with specific primers (Fw: GGTAAGCCTATCCCTAACCCTCT, Rv: AGGCGATCTGACGGTTCAC) using NEBNext Ultra II Q5 HotStart (NEB). The library insert and linearized backbone were assembled using the NEBuilder HiFi DNA assembly master mix and half of the reaction volume was transformed by electroporation into 100µL of NEB 10-beta electrocompetent E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting cDNA was PCR amplified using primers A1.MS-SDA-ADDobody-F and tonBtot_R (Table S4) using Q5 DNA polymerase (New England Biolabs) and reactions conditions according to the manufacturer’s recommendations (initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Bioengineering 2023Quote: ... NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (Catalog # E6440, NEW ENGLAND BIOLABS,MASSACHUSETTS, UNITED STATES) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Developmental Biology 2024Quote: A Primer Exchange Reaction concatemerization reaction (1X PBS; 10 mM MgSO4; dNTP, 0.6 mM of A, C, and T, NEB-N0446S ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2.5 μl 25μl p7 custom primer (Buenrostro et al. 2013) and 25 μl NEBNext Ultra II Q5 2x Master Mix (NEB) and a PCR with 10 cycles was conducted as stated in the Omni-ATAC protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total cDNA for RT-qPCR was generated from 1.5 µg total RNA using a random primer mix and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... primers oAA033-034 were used to remove mprF using the Q5 site-directed mutagenesis kit (NEB Cat. No. E0554S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL of isolated phage T4 in Pi-Mg buffer was used as a PCR template in the first PCR with the following reaction mix: 0.125 µM each primer (Supplementary Table 2) in 1x High Fidelity Master Mix (NEB) with a total volume of 10 µl ...
-
bioRxiv - Biochemistry 2024Quote: ... appropriate fragment of SynPOR gene was amplified with specific primers with additional fragments corresponding to amplified pET15b_AtPORB (Table S2) with Q5 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forward and reverse primers (100 µM) were phosphorylated and annealed using T4 Polynucleotide Kinase (PNK; New England Biolabs M0201S) and 10x T4 Ligation Buffer (Thermo B69) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA library yield was increased by a further round of PCR with Post LM-PCR oligos (Nimblegen) and Q5 High-Fidelity DNA polymerase (NEB). The PCR reaction consisted of 30 μl of the mono or di nucleosomal DNA libraries (150270 ng) ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were quantified using a Qubit fluorometer before an 18-cycle PCR amplification on bar-coded fragments with Phusion high-fidelity PCR Kit (New England Biolabs). The PCR products were cleaned using 1X vol of AMPure XP Beads.
-
bioRxiv - Bioengineering 2019Quote: VIM-T2A-mCardinal sequence was cloned from cDNA of knocked-in cells upon PCR amplification into linearized by PCR pmR expressing vector (Clonetech) and recombined using Gibson Assembly reagent (NEB). Resulting vector contained full VIM-T2A-mCardinal reading frame under the control of CMV promoter ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products were cleaned up using the Monarch® PCR and DNA clean-up kit (New England Biolabs, USA). The PCR samples were mixed with 125 μl of the DNA Clean-Up Binding Buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... of HIV env was amplified using a nested PCR approach with Phusion High-Fidelity PCR Master Mix (New England Biolabs). The outer primers were ...