Labshake search
Citations for New England Biolabs :
2051 - 2100 of 2296 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... was amplified using primers OVL7966 and OVL6481 and the PCR product was excised from a 2% agarose gel using the Monarch DNA cleanup and gel extraction kit (NEB). One-step Golden Gate Assembly (GGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The addition of an NLS or DST to level 1 and level 2 integrase constructs was performed using PCR-mediated site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 0.2 μl 50x oligos of the AarI recognition site for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher/NEB) for Level 1 cloning ...
-
bioRxiv - Biophysics 2021Quote: ... The Biotin-handle and Cosmid-I95 DNA were both digested for 2 hours at 37°C with SpeI-HF (NEB, R3133L) and subsequently heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were run on 2% agarose gels and the Quick load 100pb DNA ladder (New England Biolabs Inc., Ipswich, MA) was used for fragment size visualization ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Physiology 2020Quote: ... Germany) 1.5% agarose gel using purple gel loading dye and 2-Log DNA ladder (both New England Biolabs, Ipswich, MA, USA) at 80 V and 85 mA for 2h ...
-
bioRxiv - Neuroscience 2019Quote: ... Fixed neurons were then permeabilized and blocked simultaneously (2% normal goat serum, 5425S, New England Biolabs, and 0.1% Triton X-100) before incubation in primary antibody solutions overnight and subsequent incubation with secondary antibodies the following day.
-
bioRxiv - Cell Biology 2019Quote: ... Each sample was then split into two and incubated in the presence or absence of 2 μl of EndoH (50 U/μl: NEB#P0702S) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification of bacterial DNA was achieved by targeting the V3–V4 region of 16S rRNA gene with 30 µL final volume containing 15 µL of 2× master mix (BioLabs, USA), 3 µL of template DNA ...
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was eluted from AMPure XP beads with 80 μL elution buffer and digested with the restriction enzymes 2 μL MluCI (NEB, R0538L) and 2 μL NlaIII (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... Both primers were annealed to a DNA template and ligated by RNA ligase 2 of bacteriophage T4 (New England BioLabs Inc.). White and gray blocks represent RNA and DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed as described above and either directly resuspended in Proteinase K reaction or in 20 μl of RecJ adapter removal reaction (1X NEB Buffer 2 (NEB, #B7002S), 25U 5’ Deadenylase (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... Linearised plasmid was mixed with 2-3-fold excess of the three insert fragments followed by addition of Gibson Assembly® Master Mix (New England Biolabs) and incubation at 50°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers pM102F and pM102R (Supplementary Table 2) were designed and used in a long-range PCR reaction using the LongAmp® Taq DNA Polymerase (NEB) to amplify 40 ng of genomic DNA following the kit instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Eluted RNA was treated with T4 PNK and preadenylated linker was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (NEB, M0373L). Linker-ligated footprints were reverse transcribed using Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 µL of ChIP DNA or about 400 ng of Input DNA were added to 70 µL of blunting mix (11 µL 10X NEBuffer 2 (NEB, B7002S), 0.5 µL 10 mg/mL BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Biophysics 2021Quote: ... We isolated the total RNA from 2×107 cells using a Monarch Total RNA Miniprep Kit (T2010, New England Biolabs, MA) as described by the manufacturer with an additional 30-minute ...
-
bioRxiv - Microbiology 2022Quote: ... Bands from 200 to 400 bp were selected by extraction from a 2% agarose gel using a Monarch DNA Gel Extraction Kit (NEB#T1020L). Purified adaptor-DNA fragments were amplified by Phusion polymerase (NEB#M0530 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Master mix was added to each sample together with 1 µl truncated T4 RNA Ligase 2 (#M0239, NEB; Frankfurt/Main, Germany). Ligation was carried out for 2 h at 23°C and nucleic acids were precipitated ...
-
bioRxiv - Molecular Biology 2019Quote: ... 150 ng of double stranded gBlock® template or 2 µg of plasmid template was transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (New England BioLabs®). At the end of the reaction ...
-
bioRxiv - Genomics 2019Quote: ... three sets of ligation reactions were set up by incubating 600 ng of purified digested DNA with 2 µl of high-concentration T4 DNA ligase (NEB, M0202T) overnight at 4C in a volume of 400 µl ...
-
bioRxiv - Genomics 2019Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext® Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Genetics 2020Quote: Libraries were prepared from 2 ng of DNA using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs, USA) following the manufacturer’s instructions ...