Labshake search
Citations for New England Biolabs :
1951 - 2000 of 2296 citations for 7 METHOXY 1H QUINOLIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a double HA tagged NanoLuc to the genomic locus was reintroduced into MluI linearized pCRIS-PITChv2 vectro backbone with NEBuilder 2× HiFi assembly (New England Biolabs)51.
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2024Quote: ... After 30 mins the samples were placed on ice and 2 μl loading dye (Purple gel loading dye, no SDS, B7025 New England Biolabs) was added prior to loading 12 μl onto a 1.5% 15 x 15 cm 100 ml 0.5X TB agarose gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysed by incubation in 1000 μL RIPA buffer + 2 mM PMSF + 60 μL PIC + 112.5 Kunitz Unit/mL DNase I (RNase-free, NEB M0303) + 2.5 mM MgCl2 (Sigma 5985-OP ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... 2 kb fragments upstream and downstream of SrcF were PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs) and cloned in PCR amplified pEx-deletion-ermG via DNA Gibson assembly (HiFi DNA Assembly Master Mix ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size-selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 nM of RCA primer, 1U/µL of RiboProtect (Blirt, #RT35) and 0.5 U/ µL of T4 RNA Ligase 2 (NEB, # M0239L). The ligation mix was introduced to the SecureSeal chamber and incubated on the samples for 2 hours at 37 degrees Celsius ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were boiled for 10 min and 2 μL of 20 mg/ml proteinase K (New England Biolabs, Cat. #P8107S) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SNAP-tagged histones neosynthesized during the chase time were then pulse-labelled by incubating cells with 2 μM of the red-fluorescent SNAP reagent SNAP-cell TMR star (New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Genetics 2023Quote: ... the region containing the target surrounded by the context was amplified by PCR using primers P7-P8 with Q5 Hot Start High-Fidelity 2× Master Mix (NEB) with the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... the repair vector GW209_pCRIS-PITChv2-C-dTAG-Puro (BRD4) (2 μg) was digested with MluI-HF (New England Biolabs; #R3198) in Cutsmart Buffer for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...