Labshake search
Citations for New England Biolabs :
2051 - 2100 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Genes of interest were amplified with the One Taq One-Step RT-PCR kit (NEB) using 1 μg of RNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... 7 μL Q5 high GC enhancer (NEB), 0.07 μL 100mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... These custom carbon fiber microelectrodes have passed a successful Ethylene Oxide Sterilization Exposure and Sterility Audit conducted by BioLabs to ensure preoperative ethylene oxide treatment fully sterilizes the carbon-fiber microsensor electrodes ...
-
bioRxiv - Genetics 2024Quote: ... The sheared DNA was used as input for the NEBNext Enzymatic Methyl-seq (NEB E7120) following the manufacturer’s instructions except for doubling the reaction incubation times ...
-
bioRxiv - Molecular Biology 2021Quote: ... A preadenylated universal linker (5’-rAppCTGTAGGCACCATCAAT-NH2-3’) was prepared in house or purchased from NEB (S1315S) and ligated to the 3’ ends of the dephosphorylated footprints using T4 RNA Ligase 2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Subsequently 5’ and 3’ termini were ligated using 10 units of T4 RNA ligase (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... two oligos (see Supplementary Table 3) were annealed and 5’ phosphorylated (T4 Polynucleotide Kinase kit, M0201S, NEB) as described previously (LentiGuide-Puro and LentiCRISPRv2) ...
-
m7G cap-eIF4E interaction stimulates polysome formation by enhancing first-round initiation kineticsbioRxiv - Biophysics 2021Quote: ... 5’-end capping and 3’-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3’ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µl Antarctic phosphatase [5 U] and 7.32 µl Antarctic phosphatase buffer (both New England BioLabs, Germany). The reaction was heat-inactivated at 85°C during 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... as follows: 1µL of 2µM MBTUni-12 primer (5’-ACGCGTGATCAGCRAAAGCAGG-3’) + 1µL 10mM dNTPs Mix (NEB #N0447S) + 8µL Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA fragments were directly 3’-end dephosphorylated using 5 U of Antarctic Phosphatase (New England Biolabs, UK) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2019Quote: Second-strand extension was performed using Klenow 3’ → 5’ exo− fragment (New England BioLabs, Ipswich, MA USA). Double-stranded cDNA was amplified using AmpliTaq Gold polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer Y111E: 5’-TTGATGGAGACATTCTTC-3’) using the Q5 site-directed mutagenesis kit (E0554S, New England Biolabs) to generate a point mutant ...
-
bioRxiv - Biophysics 2021Quote: ... 5′-end capping and 3′-end biotinylation were performed using the Vaccinia Capping System (New England Biolabs) and the Pierce RNA 3′ End Biotinylation Kit (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA fragments were directly 3’-end dephosphorylated using 5 U of Antarctic Phosphatase (New England Biolabs, UK) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... CVO689-CVO586 (integrant 5’ end) and CVO321-CVO183 (integrant 3’ end) using Q5 Polymerase (New England Biolabs). PCRs were set up according to manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... which was dephosphorylated at the 5’-end with 3 µl of Quick-CIP (5000 U/µl, NEB) in a total volume of 20 µl according to manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... 1μg RNA was incubated with 1 unit XRN1 (New England Biolabs) or water for 2hr at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 unit Phusion DNA Polymerase (New England Biolabs; Ipswich, MA, USA), and 30-50 pg template ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μL of dNTPs (final concentration 0.5 mM, New England BioLabs), 0.5 μL of Taq polymerase (corresponding to 2.5 units ...
-
bioRxiv - Genetics 2021Quote: ... 1 µl precipitated DNA sample and 0.3 U Q5 polymerase (NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... 1 nl of a solution containing 10µM EnGen Cas9 NLS (NEB) and 100 ng/µl of gRNAs was injected at the one-cell stage ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 U per microliter murine RNase inhibitor (Biolabs ref: MO314S). Ribosome-protected fragments (RPF ...
-
bioRxiv - Genomics 2020Quote: ... with 1 μl (20 U/μl) of DpnI restriction enzyme (NEB) in a final volume of 20 μl at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... 72°C for 1 min)) using NEBNext 2x Master Mix (NEB) and Nextera adapters and put on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first duplicate was deglycosylated by PNGase F (NEB, 1:100) overnight at 37°C in 50 mM ABC prepared in pure H2O18 ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed once with 400 μl 1× Quick ligation buffer (NEB, M2200) and resuspended in 46.5 μl of 1× Quick ligation buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS) containing 400 μg/mL Proteinase K (New England Biolabs) and incubated at 65 °C for 1 hr with rotation at 300 RPM ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... reaction buffer containing 1 μL (400 units) lambda phosphatase (P0753S, NEB), reaction buffer containing 1 μL lambda phosphatase plus 1×phosphatase inhibitors cocktail (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 µl of T4 DNA ligase buffer 10X (NEB cat. B0202), 0.5 µl of 1 mg mL−1 purified bovine serum albumin (1:20 dilution in dH2O of BSA ...