Labshake search
Citations for New England Biolabs :
2001 - 2050 of 2873 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... The sample was chilled to halt the denaturation process and GlycoBuffer 2 (New England Biolabs), NP-40 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 ug of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (NEB) and ARTIC V3 (MHome ...
-
bioRxiv - Microbiology 2023Quote: ... a fragment including the SARS-CoV-2 RdRp catalytic residue was subcloned into pUC19 (NEB) and the resulting pUC19-RdRp was mutated at the RdRp catalytic residue by inverse PCR using mutation-introducing primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and library preparation was performed using the NEBNext ARTIC SARS-CoV-2 FS kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The cutting vector GW223_pX330A_sgX_sgPITCh (2 μg) was digested with BbsI-HF (New England Biolabs; #R3539) in Cutsmart Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For AsiSI digestion, samples were equilibrated (2 min, RT) in 150 µL CutSmart buffer (NEB). 3µl recombinant AsiSI endonuclease (10U/µL ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed by combining 12.5 µL Q5 high-fidelity 2× master mix (NEB), 2.5 µL each of 10 µM forward and reverse primers ...
-
bioRxiv - Genomics 2022Quote: ... were enriched from total RNA using the SARS-CoV-2 / TBRV MagIC beads (ElementZero Biolabs) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of gRNA was mixed with 3.3 μL of Spy Cas9 NLS (NEB, UK) and incubated for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... After digestion the linearized backbone was dephosphorylated by addition of 2 µl rSAP (NEB, #M0371S) and incubation at 37 °C for 1 hour followed by heat inactivation of the enzymes at 80 °C for 20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... 2) the CYC terminator by digesting pDL00212 with HindIII-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Bioengineering 2024Quote: ... 2) parts were either synthesized as fragments (Twist Bioscience) and subsequently PCRed using Q5 (NEB), or synthesized as duplex oligos (IDT) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... 1-3 μg RNA was used to generate sequencing libraries with NEBNext Ultra™ RNA Library Prep Kit for Illumina (#E7530L, NEB, USA) with poly(A ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and reverse primer (5’-AAG ATT CTC GAG ATG GTG ATG GTG ATG G-3’) were combined using the Q5 site-directed mutagenesis protocol (New England Biolabs, Ipswitch, MA). The resulting plasmid ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... The BAC containing viral cDNA was cleaved at a unique restriction site located downstream of the 3’-end poly(A) tail using NotI-HF (Ref. R3189S, NEB, Grenoble, France). In parallel ...
-
bioRxiv - Microbiology 2021Quote: ... HA tag sequences were added to the 3’ end of the hACE2 transgenic cDNA using a Q5® Site-Directed Mutagenesis Kit (NEB#E0554S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Cell Biology 2020Quote: The myo-3p::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974 ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...