Labshake search
Citations for New England Biolabs :
1851 - 1900 of 2873 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Samples requiring dephosphorylation were treated with 2 U/μL λPP (New England Biolabs, # P0753) for 3 h at 30°C and then washed with PBSCM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNase I (2 µL, 2,000 U/ml, RNase-free, New England Biolabs, Ipswich, MA), 10× DNase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted into the pGLuc Mini-TK 2 Gaussia luciferase enhancer reporter plasmid (NEB) via KpnI/SacI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and nuclei were resuspended in 2 mL 1x NEBuffer 3.1 (New England Biolabs; B7203S) + 20uL NxGen RNase Inhibitor.
-
bioRxiv - Molecular Biology 2022Quote: ... were ligated to dephosphorylated RNAs using T4 truncated RNA ligase 2 (K227Q) (NEB, #M0351L). Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting nucleic acids were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction with T4 RNA ligase 2 was performed in 1x T4 Rnl2 (NEB) supplemented with PEG 8000 (10% ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA samples were treated using 2 units of DNase I (New England Biolabs) according to the manufacturer’s instructions to eliminate residual gDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of 10x T4 DNA Ligase Buffer with 10 mM ATP (NEB, B0202S), 1 μL of PaqCI/AarI activator (5 pmol ...
-
bioRxiv - Physiology 2023Quote: ... for every 2 µg of fusion protein in 1X TEV buffer (Catalog P8112S, NEB) for 16h at 30°C.
-
bioRxiv - Cell Biology 2023Quote: ... The eluted sample was incubated with 2 ml amylose resin (New England Biolabs, E8021L) for 1 h at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 μL PCR reactions were set-up using 2 μL 5x HF Buffer (NEB), 0.5 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... 2 pmol were digested to single nucleosides using the Nucleoside Digestion Mix (NEB # M0649), and the ratio of Ψ s versus uridines was determined via tandem quadrupole mass spectrometry (Supplementary Figure S2a).
-
bioRxiv - Microbiology 2023Quote: ... 20-μL reactions contained 2 μM enzyme and 250 μM NTPs (New England BioLabs) in reaction buffer with 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Microbiology 2023Quote: ... The annealed constructs were ligated using 2 µL T4 RNA ligase2 (NEB, 10U/µL), 3 µL 0.1% BSA (Ambion) ...
-
bioRxiv - Molecular Biology 2023Quote: ... two pairs of oligonucleotides (Suppl. Table 2) were phosphorylated and ligated into BsbI (NEB) digested pDG459 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... a pair of oligonucleotides (Suppl. Table 2) was phosphorylated and ligated into BsbI (NEB) digested pX459 and pX458 plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... 11 uL Exonuclease I Buffer and 2 uL Exonuclease I (New England Biolabs; M0293S) was added following reverse transcription and incubated at 37 °C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Forked adapters (Supplementary Table S7) were annealed in NEBuffer 2 1X (NEB cat. B7002S) to a final concentration of 20 µM in a thermal cycler set to heat at 98°C and gradually cool down to 4°C with a 1°C per 20 sec gradient.
-
bioRxiv - Genomics 2023Quote: ... 0.4 μL RNase Inhibitor and 2 μL Induro RT (200 U/μL; NEB M0681S) were incubated for 15 minutes at 60°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 µL of reactions were treated with 2 µL DNase I (NEB, Cat # M0303S) in a total volume of 100 µL at 37°C for ∼ 20 min before further analysis and treatment.
-
bioRxiv - Immunology 2023Quote: ... and 2 µL of home-made Gibson mix (T5 exonuclease (0.2U; New England Biolabs), Phusion polymerase (12.5U ...
-
bioRxiv - Developmental Biology 2024Quote: ... R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs, R0158S) for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... and mixed with an equal volume of 2 x RNA loading dye (NEB, B0363S). 25 μl of the mixture was loaded on a 10% TBE-Urea gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... all kinases were tested for activity using 2 µg each of histone H1 (NEB) or Myelin Basic Protein (MBP ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 pmol of an equimolar mixture of all gene-specific oligos for each gene were mixed with 250 pmol of the appropriate FLAP oligo in 1x NEBuffer 3 (New England Biolabs, B7003), then incubated in a Thermocycler (BioRad ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Cell Biology 2019Quote: ... Homologous 15bp overhangs on the 3’ end of the inverse PCR primers were ligated following the NEB T4 Ligation protocol (New England Biolabs # M0202S) to introduce the 5AA sequence ...
-
bioRxiv - Cell Biology 2019Quote: A derivative vector from modified TMPrtTA (3, 70) was created with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Backbone was digested with EcoRV-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... We tested various restriction digestion conditions in order to reliable separate all transgene copies (Sup. Fig. 3) and decided to perform overnight digestions with HindIII-HF or DpnII (NEB, USA) in CutSmart buffer ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Microbiology 2021Quote: ... the SAG1 3’UTR was amplified from pNJ-26 and cloned into the tagging plasmid to replace DHFR 3’UTR by Gibson assembly (NEB, E5520S). BAG1-mCherry GCaMP6f reporter tachyzoites were co-transfected with 10 μg of pSAG1::CAS9-U6::sgDHFR 3’UTR and 2 μg of PCR amplified P2A-mTagBFP2-HXGPRT flanked with 40 bp homology regions ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...