Labshake search
Citations for New England Biolabs :
2001 - 2050 of 2067 citations for 5 Sulfosalicylaldehyde sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Microbiology 2021Quote: ... and total of 5 μg of the five fragments was ligated in an equal molar ratio by T4 DNA ligase (New England Biolabs, Ipswich, MA) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: Vector pFLD was digested with PmlI at 37°C for 2 h and dephosphorylated with 5 U Antarctic phosphatase at 37 °C for 30 min as recommended by the manufacturer (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Cancer Biology 2022Quote: ... to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs, Cat. # M0351L). The resulting tRNAs were then ligated to a 5’-adaptor ...
-
bioRxiv - Bioengineering 2022Quote: Reunion of 4-6 nM of dsDNA template (gblocks® Gene Fragment, IDT) to a solution of 5 U/μL of T7 RNA polymerase (NEB, M0251), 200 nM Cas9 (S ...
-
bioRxiv - Biochemistry 2022Quote: ... and the impurities that were tagged by Chitin Binding Domain were extracted on a gravity-flow column using 5 mL Chitin resin (New England BioLabs, Evry, France). The target proteins were purified with HisTrap HP columns (GE Life Sciences ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting fragment was subjected to error-prone PCR under the following conditions: 5 U of Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... before being incubated in 5% normal goat serum dissolved in PBS-TX (NGS-PBS-TX; NGS; New England BioLabs, Hitchin, Hertfordshire, UK) for a minimum of one hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcribed RNAs were treated with Antarctic phosphatase (Fermentas, Waltham, MA) to remove the 5’ terminal phosphate and then labeled by T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA) in the presence of γ-32P-labeled ATP (PerkinElmer ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Molecular Biology 2024Quote: ... attB plasmid containing genes for tdMCP-protein fusions and a MS2-circRNA barcode were digested overnight at 37°C to remove existing barcode sequence (2 μg plasmid, 5 μL 10x CutSmart buffer, 2 μL BsrGI-HF (NEB cat#R3575S), nuclease-free water to 50uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was digested by combining the following and incubating overnight at 37°C: 2 μg plasmid + 5 μL CutSmart buffer (10x) + 2 μL AflII (NEB cat# R0520S) + 2 μL BlpI (NEB cat# R0585S ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The amplicons were purified and subjected to error-prone PCR under the following conditions: 5 U Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 5’ phosphorylated 3’ end adapter featuring 4 randomized nucleotides at the 5’ terminus and a 3’ blocking group (3C Spacer; 3SpC3, IDT) underwent adenylation using Mth RNA ligase (New England Biolabs, cat# M2611A). Adapters were subsequently ligated to deacylated and demethylated RNA templates using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... 100ng of vector backbone and 20ng of trcrRNA-CaptureSeq-5’LTR(truncated) cassette were combined with 10 μl of NEBuilder HiFi DNA assembly master mix (NEB cat. no. E2621L) and water to 20 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... A portion of leaf tissue (approximately 5 mm2) was homogenized by grinding in 50 μL of 1X Q5 reaction buffer (New England Biolabs Cat. No. B9027S) in a 1.5 mL microcentrifuge tube with a micropestle ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample was analyzed in duplicate 10-µl reactions containing 5 µl Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA), 2 µM of each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... a volume of 0.5 µl of the respective restriction enzyme BbsI (5 units; ThermoFisherScientific, Waltham, US) or BsaI-HF®v2 (10 units; New England Biolabs, Ipswich, US) and then 1 µl (1-3 units ...
-
bioRxiv - Microbiology 2020Quote: ... of which 5 μl was processed with the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England Biolabs) with previously published modifications to the manufacturers protocol 37 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA (2.5 μL) was amplified in two multiplexed PCR reactions using Q5 Hot-Start DNA High-fidelity Polymerase (New England Biolabs, Ipswich, MA, USA) using the following cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... followed by with a buffer adapted from (5-9) consisting of 0.1% (1mg/mL) BSA (New England Biolabs, Ipswich, MA, Item No. B9000S) / 0.3% Igepal CA 630 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...