Labshake search
Citations for New England Biolabs :
1651 - 1700 of 2067 citations for 5 Sulfosalicylaldehyde sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... and Gibson-assembled in a final volume of 5 µl using NEBuilder HiFi DNA assembly master mix (NEB, Ipswich, MA), according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... A K13 propeller domain-specific guide gRNA was introduced into this vector at the BbsI restriction sites using the oligo pair p1+p2 (Supplementary file 5) using T4 DNA ligase (New England BioLabs). Oligos were phosphorylated and annealed prior to cloning ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Flanking primers contain 20 bp of 5’ and 3’ overlap with the pcDNA3.1 vector for Gibson Assembly (New England Biolabs, #E5510). The resulting library had an estimated complexity of 322 = 1024 codon variants and 202 = 400 amino acid variants ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR reaction was simplified to include 5 μl NEB Q5 Hot Start High Fidelity Master Mix (New England Biolabs), 1μl of the LCO_mod primer ...
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Biochemistry 2021Quote: ... The tested interference substrates of either target strand (TS) or non-target strand (NTS) were 5′-radiolabeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was then supplemented with 5 mM DTT and the same concentrations of T4 polynucleotide kinase (New England BioLabs) and [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA (50 pmol) was radiolabelled at 5′ end with by using 10 units of T4 polynucleotide kinase (New England Biolabs) mixed to 3 μl of γ32P-ATP (3000 Ci/mmol 10 mCi/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... Biotin removal from unligated fragments was performed by incubating DNA samples for 4h at 20C in a mix of 5 mL of 10X NEB2 buffer (New England Biolabs), 5 mL of a 1mM dNTPs mix ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Genetics 2021Quote: ... An AMA1 replication vector backbone (pFCBB) of 10,129 bases was obtained from pFC332 (5) by restriction digest using PacI and BamHI-HF® (NEB), excising part of the Nt.BbvCI –PacI cloning site ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fragment was amplified by PCR using primers piLepF1 (5“-TCTACAAATCATAAAGATATTGGAAC-3”) and LepR1 (5“-TAAACTTCTGGATGTCCAAAAAAATCA-3”) (Hebert et al., 2004) using OneTaq Mastermix with standard buffer (New England Biolabs) under standard cycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5–1 μg of circFL-seq cDNA was repaired and dA-tailed by the NEBNext FFPE DNA Repair Mix (NEB) and NEBNext Ultra II End repair/dA-tailing Module (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... 70°C for 10s and 72°C for 30s) and 1x 72°C for 5 min) using the Q5 polymerase (New England BioLabs) and cloned into pUC57 using the MEGAWHOP35 method ...
-
bioRxiv - Immunology 2021Quote: ... 3’ arm of homology to exon 5 was cloned into BamH1-NotI-digested PL451 (contains Neomycin cassette and loxP; NCI Frederick) using T4 DNA Ligase (NEB). Third ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 PCR2 reactions were used per timepoint with 5 μL of PCR1 product amplified with 25 μL Q5 High Fidelity 2X Master Mix (NEB), 5 μL of 10 μM primer mix in 50 μL volume using the following PCR protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene specific primers with restriction sites added to the 5’ end were used to amplify the full CDS or gene fragments using Q5 DNA Polymerase (NEB). Primer sequences and restriction sites used for each construct can be found in Table S8 ...
-
bioRxiv - Genomics 2021Quote: ... Array DNA used in directed methylation experiments was then biotinylated by filling in EcoRI and XbaI 5’overhangs with dGTP (NEB), α-thio-dCTP (Chemcyte) ...
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... RNA was ligated overnight at 16°C at 5’ with DNA/RNA chimeric oligonucleotide adaptor (TCAGACGTGTGCTCTTCCGATCTrNrNrWrNrNrWrNrN, TIF2-RNA in Supplementary Table S1 using T4 RNA ligase (NEB) in the presence of 10% dimethylsulphoxide (DMSO) ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... Crosslinked cells were washed twitch with phosphate buffered saline (PBS) contains 5% vanadyl complex (New England Biolabs, Cat. No. S1492S) and 1 mM Phenylmethanesulfonyl fluoride (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then transferred to a fresh low-bind tube containing pre-washed 5 µl amylose magnetic beads (NEB) and rotated for 45 min at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Microbiology 2022Quote: ... Radioactive probe was prepared using 40 pmol of primer 59 and 5’-labelled with 10 U of T4 Polynucleotide Kinase (New England Biolabs) and [γ32P]ATP (150 μCi) ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription was initiated upon addition of 4 nM of dsDNA template (gblocks Gene Fragment, IDT) to a solution of 5 U.μL-1 of T7 RNA polymerase (NEB, M0251), 1 U.μL-1 of murine RNase Inhibitor (NEB M0314) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and containing the sequence DuxblExon 5-iRFP702-Duxbl3’UTR after amplifying the corresponding sequences by PCR followed by Gibson assembly (New England Biolabs) (Supplementary Table 8) ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... the beads were resuspended in TEV buffer (final volume 5 mL) with 100 μL TEV protease (New England BioLabs, #P8112S) and incubated at 4°C on a roller overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA (5-10 μg) derived from transfected ESC was digested by high concentrated HindIII-HF or high concentrated BamHI-HF (NEB). In all Southern blot analyses ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... 5’-TTAGAAGAACCGGTCTTCAGTATG-3’ and 5’-CTGTAGGCAAGAAAGCAGAGTATTGTCA-3’) on genomic DNA of pooled or individual embryos followed by digest with XhoI (NEB). Following validation of knock-in ...
-
bioRxiv - Immunology 2022Quote: ... cells were brought to 5×105 cells/ml and incubated with transposition reaction mix (NEBNext High-Fidelity 2X PCR master mix, NEB) for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... 5 ng of the synthesized oligo pool were carried out using the Phusion High Fidelity DNA Polymerase (New England Biolabs), with a total of 15 cycles and an annealing temperature of 56 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5′ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by another round of PAGE purification ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The thyA gene region was amplified from the genomic DNA (5 ng) with Phusion High-Fidelity PCR Master Mix (New England Biolabs) using 200 nM of thyA forward and reverse primers that give amplicons of 750 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was fragmented at 95°C for 5 min by using a Next Magnesium RNA Fragmentation Module (New England Biolabs), and cleaned up by using a MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...