Labshake search
Citations for New England Biolabs :
151 - 200 of 2482 citations for tert Butyl trans 17 bromo 4 7 10 13 tetraoxa 15 heptadecenoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554). Adeno-associated viruses (AAV ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cloned into the vectors pX335 and pKN7 17 after digestion by the Type IIS restriction enzyme BbsI (New England Biolabs, R3539) as previously described 64.
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Genomics 2021Quote: ... 15 μL of MboI restriction enzyme (New England Biolabs R0147) was used for digesting chromatin from 15 million MEFs ...
-
bioRxiv - Biochemistry 2022Quote: ... Then complexes were bound to 15 µl amylose agarose (NEB) by rotating the tube at 4 °C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... End-repair/A-tailing was performed on 17 μL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by ligation (MNase_F/MNase_R ...
-
bioRxiv - Microbiology 2020Quote: ... pCrPV-1A-DcDV was linearized by inverse PCR with primers 17 and 18 and the linearized plasmid was circularized by blunt end ligation with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions to create pCrPV-1A-DcDV-1A ...
-
bioRxiv - Bioengineering 2022Quote: ... End-repair/A-tailing was performed on 17 μL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by ligation (MNase_F/MNase_R ...
-
bioRxiv - Molecular Biology 2022Quote: ... end-repair/A-tailing was performed on 17 µL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by adapter ligation using T4 DNA Ligase (New England BioLabs) ...
-
bioRxiv - Genomics 2022Quote: ... A restriction digestion mix containing 7 µl of 10X NEB CutSmart Buffer (NEB #B7204), 4.5 µl of NlaIII (NEB #R0125) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Cell Biology 2020Quote: ... Oct-4 (NEB, D7O5Z), Sox2 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ml ScaI (BioLabs), followed by 3 h of incubation with a fresh portion ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1mM DTT) before adding 15 µl 1 mg/ml Streptavidin (NEB) before immediate wash with DLB-C-T buffer (DLB supplemented with 1 mg/ml α-casein ...
-
bioRxiv - Cell Biology 2023Quote: ... Klenow fragment (5 U) & T4 polynucleotide kinase (15 U) (NEB; M0201). The A-tailing was performed with Klenow exo-fragment (15 U ...
-
bioRxiv - Genomics 2024Quote: ... 15 μl of 400 U/μl T4 DNA ligase (NEB, M0202L), followed by 4h incubation at RT with gentle rocking ...
-
bioRxiv - Cell Biology 2024Quote: ... for 15 minutes at 37C and then BsmBI- V2 (NEB #R0739S) was added for a second digest at 55°C for 20 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... plus 15 μL Prot K (T2010, New England Biolabs, MA, USA) was added to the tissue homogenate and incubated at 55°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Genomics 2024Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs, Ipswich, MA). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL 10% NP-40 (NEB), 10 μL PNGase F (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µL MnCl2 (10 mM NEB), 10 µL phosphatase buffer (10x PMP buffer ...
-
bioRxiv - Developmental Biology 2020Quote: 5-7 μg of HiC library in a total volume of 100 μl (1x NEB buffer 2.1 ...
-
bioRxiv - Genetics 2021Quote: ... 7 μg of ligated chromatin was digested with 10U specific second cutter NlaIII (R0125S, NEB) in 100 μl system with CutSmart Buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: SLC25A46 was amplified through PCR with Taq-polymerase with 7-deaza GTP/nucleotide mix (NEB) using cDNA from control fibroblasts as a template and cloned into Gateway modified pBABE-Puro using Gateway Cloning Technology (Invitrogen) ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... Mutant segment 7 plasmids were generated through Q5 Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
bioRxiv - Microbiology 2024Quote: ... were double digested using the appropriate restriction enzymes (Supplementary Table 7) (NEB, Ipswich, MA, USA). The digested inserts and plasmids were ligated using the T4 DNA ligase ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB ligase (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: Escherichia coli strains DH5α [15] and ER2523 (New England Biolabs, Ltd., UK) were grown in Luria Bertani (LB ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 μg protein was mixed with 15 μL Glycoprotein Denaturing Buffer (NEB) in 150 μL total volume and incubated at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Biochemistry 2023Quote: ... 15% PEG8000 and 20 U T4 RNA ligase 2 truncated KQ (NEB)) ...
-
bioRxiv - Biochemistry 2024Quote: 15 μg of recombinant LyLAP was deglycosylated using PNGase F (NEB, P0704) in either native or denaturing conditions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 4 mM dNTPs (NEB #N0447L), 250 nM PAGE-purified forward and reverse primers ...