Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR (quantitative reverse transcriptase PCR) was then performed using a Luna® Universal One-Step RT-qPCR Kit (New England Biolabs; E3005) per manufacturer’s instructions and primers for the CaSeq1 gene of interest (IDT ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was conducted using the Q5 High-Fidelity 2X Master Mix (NEB). All primers used in the current study are available in Table S1.
-
bioRxiv - Cell Biology 2022Quote: ... The purified RT-PCR products were double digested by BamHI and XbaI (NEB) and then ligated into pBiFC-Flag-VN or -YC vectors by T4 DNA ligase or when these two restriction enzymes had cut sites within the cDNA sequences ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR using Luna® Universal qPCR Master Mix (New England BioLabs) was performed with the following cycling conditions on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR (qRT-PCR) was performed in duplicate with the Luna® Universal qPCR Master Mix (NEB, M3003) using QuantStudio 5 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... or Luna Universal One-Step RT-qPCR Kit (NEB) and 1.5 μl of reference primer/probe sets CDC-N1 (IDT 10006713 ...
-
bioRxiv - Bioengineering 2024Quote: LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA using primers oAS344 for cRNA and oAS345 for vRNA (Supplementary Note 21).
-
bioRxiv - Microbiology 2023Quote: ... the LunaScript® RT Super Mix Kit from NEB was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... or using NEB LunaScript RT SuperMix kit (NEB #E3010L). In both cases ...
-
bioRxiv - Cell Biology 2019Quote: ... SNAP-FOR1(3P,FH2) protein was labeled with SNAP-549 dye (New England Biolabs, Ipswich, MA) as per manufacturer’s instructions prior to each TIRF experiment.
-
bioRxiv - Microbiology 2021Quote: ... RT was performed using 1 μg of RNA using LunaScript™ RT SuperMix Kit (New England BioLabs) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR experiments were performed with the Luna® Universal One-Step RT-qPCR Kit (NEB, #E3005E) with a final reaction volume of 10 μL per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian cell lines were handled under sterile conditions using a laminar flow hood and the cells were regularly tested for mycoplasma contamination with a PCR-based mycoplasma detection kit (Minerva-Biolabs, cat.no. 11-1250). Subcultivation was performed every 2-4 days at a confluence of maximum 80 % using trypsin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription and quantitative PCR were performed in one step using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA). The primers used are listed in supplemental table (Table ...
-
bioRxiv - Molecular Biology 2022Quote: ... We generated cDNA with random hexamers for qRT-PCR) or oligo(dT) primers for RT-PCR using M-MLV (NEB). We carried out semi-quantitative RT-PCR using DreamTaq (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR analysis was performed using Luna® Universal qPCR Master Mix (NEB) and Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... and RT-PCR was performed with Phusion High Fidelity DNA polymerase master mix (NEB) each with the manufacturer recommended PCR thermal cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Cancer Biology 2024Quote: Quantitative RT-PCR was done with the Luna Universal qPCR Master Mix (#M3003, NEB,) using a QuantStudio 5 Real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed using LunaScript RT SuperMix Kit (NEB). Polymerase chain reactions were carried out using TaqMan 2X Universal PCR Master Mix or SYBR Green PCR Master Mix (Thermo ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was performed using LunascriptTM RT Supermix Kit (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Luna Universal One-Step RT-qPCR kit (New England Biolabs) was used following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using LunaScript RT SuperMix Kit (NEB). Oligonucleotides used for qRT-PCR are listed in Supp ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was generated using LunaScript RT Master Mix Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Luna® Universal One-Step RT-qPCR Kit from NEB was used for RT-qPCR reactions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Bioengineering 2024Quote: ... The LunaScript Primer-Free RT Master Mix Kit (NEB E3025S) was used to generate cDNA per manufacturer protocol ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Microbiology 2023Quote: ... and cDNA generated using LunaScript® RT Supermix kit (NEB). qPCR was performed using Luna® Universal qPCR Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was generated by using LunaScript RT SuperMix Kit (NEB) and qPCR was performed with the Luna universal qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Frankfurt am Main, Germany) and a CFX96 Real-Time System ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and RT-qPCR was performed using the Luna Universal Onestep RT-qPCR kit (New England Biolabs, Ipswich, Massachusetts, USA) on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed in 384 well format with Luna Universal Probe One-Step RT-qPCR Kit (NEB), assaying Fluc (primers oHR711/712 ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCR was conducted in technical triplicate using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s instructions in 10 µl reaction volumes and reactions were run on a CFX Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using Luna® Universal Probe One-Step RT-qPCR kit (E3006L; New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2023Quote: ... and the RT-qPCR master mix prepared using a Luna Universal One-Step RT-qPCR Kit (New England Biolabs), as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-PCR was performed using the Phusion® High-Fidelity DNA Polymerase (NEB, Evry, France) according to the manufacturer’s protocol in a 50-μl reaction mixture using forward primer 5’-ATGGATGTATGCGTCCGTCT-3’ and reverse primer 5’-CTACTTCTTAAGAGGCTTCT-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed with 10 ng of total RNA using OneTaq (New England Biolabs) PCR reaction system with the primers listed in Table S3 ...
-
bioRxiv - Neuroscience 2023Quote: Quantitative (q) RT-PCR was carried out using the Luna Universal qPCR Master Mix (NEB) in the CFX384 Real-Time system (Bio-Rad ...