Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... yoaALexAp1 5’-GCGCCCTCAT CCTGACATAA TGTCCCTTCA AATCAAGGGA CGGTAGTGTG ACGGAC-3’ and yoaALexAp2 5’-GTCCGTCACA CTACCGTCCC TTGATTTGAA GGGACATTAT GTCAGGATGA GGGCGC-3’ and amplification with the Phusion High-Fidelity DNA Polymerase PCR kit (New England BioLabs). Constructs were sequence verified.
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by addition of 3’-A overhangs using Klenow Fragment 3’-5’ exo- (NEB, M0212S). After denaturation of DNA at 95°C for 3 min ...
-
bioRxiv - Cell Biology 2021Quote: ... A-tailing 3’ end was performed using Klenow Fragment (3’→5’ exo-) (New England Biolabs), and then TruSeq Adapters were ligated by Quick T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Pre-miRNAs were purified on denaturant polyacrylamide gel and long pri-miR-K10/12 derived transcripts (up to ∼3 kb) were salt purified using Monarch® PCR and DNA cleanup kit (New England BioLabs). After acidic phenol extraction and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting amplicon was assembled with a hHBB-Nluc sequence that lacked a 3’ UTR but maintained a unique barcode using a NEBuilder HiFi Assembly Kit (NEB, ES2621).
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Neuroscience 2023Quote: ... we introduced a silent mutation into the PAM motif of the sgRNA located within the 3’ homology arm in the donor plasmid by using Q5 Site-Directed Mutagenesis kit (NEB, E0054). The donor plasmid was confirmed with DNA sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the pML104-GAL1 vector has a guide sequence 5’- CTCTTAAATTATAGTTGGTT-3’ introduced by Q5® Site-Directed Mutagenesis Kit (New England Biolabs) (Hu et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The 2X FLAG sequence was introduced via PCR as an oligonucleotide primer along with a reverse primer that produced the 3’ CNA1 UTR and cloned by use of the Gibson Assembly Cloning Kit (NEB #E5510S). The identity of the vector pCnat-CNA1-2X FLAG was also confirmed by sequencing.
-
bioRxiv - Microbiology 2023Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The pRNA destination backbone was linearised by primers s5 and s6 (Table 3) and assembled with the mScarlet-I3 fragment using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pRNA-mScarlet-I3 destination vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3’ end filling and dA tailing was performed by Klenow Fragment (3’>5’ exonuclease deficient; NEB). Libraries were prepared by ligation of NEBNext adapters and indexed i7 primers (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Molecular Biology 2021Quote: ... 3 ml of Thermolabile ExoI (BioLabs) was added to each reaction and samples were incubated for 15 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... 3 µL Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Genomics 2019Quote: ... 3 U Klenow exo (NEB M0212S)] to the 32 µL of DNA sample from the previous step ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Molecular Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’ overhangs removed with Klenow (NEB) to form blunt ends ...