Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µl freshly made 1 M NH4HCO3 and calf intestinal alkaline phosphatase (1 U, New England Biolabs) were added ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... rRNA was removed from 3 replicates with NEBNext Bacteria rRNA Depletion Kit (New England Biolabs), while the other 3 were treated with NEBNext Depletion Core Reagent Set using custom probes targeted to Haloferax volcanii rRNA (Martinez-Pastor and Sakrikar ...
-
bioRxiv - Microbiology 2021Quote: ... coli MG1655 genomic DNA into pKK223-3 by NEBuilder HiFi DNA Assembly Cloning Kit (NEB) and the first 300 bp portion of leuA was translationally fused with the nano-Luc (nLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Microbiology 2023Quote: ... The 3 fragments were ligated using the Gibson Assembly® Cloning Kit (New England Biolabs). The created pEXG2::ΔfahA and pEXG2::ΔpanC were transformed into E ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Genomics 2019Quote: ... in 1× Buffer 3 (Bionano Genomics) or 120 U of Nb.BssSI (New England Biolabs) in 1× NEBuffer 3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these products were ligated to a 3’ adapter (1× T4 RNA ligase buffer (NEB), 10% PEG-8000 ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for Level 1 and 3 assembly and SapI (New England BioLabs, USA) for Level 2 assembly ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Cancer Biology 2020Quote: ... two oligos (see Supplementary Table 3) were annealed and 5’ phosphorylated (T4 Polynucleotide Kinase kit, M0201S, NEB) as described previously (LentiGuide-Puro and LentiCRISPRv2) ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer Y111E: 5’-TTGATGGAGACATTCTTC-3’) using the Q5 site-directed mutagenesis kit (E0554S, New England Biolabs) to generate a point mutant ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA (28 ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...