Labshake search
Citations for New England Biolabs :
151 - 200 of 1434 citations for GA binding protein alpha chain GABPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Genomics 2020Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB, S1421S) before and in between the following procedures ...
-
bioRxiv - Biophysics 2020Quote: ... for the substrate-binding domain mutants and βamHI-AlwnI (NEB) for the transmembrane domain mutants (Appendix) ...
-
bioRxiv - Genomics 2022Quote: ... Nascent RNA was purified by binding streptavidin beads (NEB S1421S) and washed as described by Mahat et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... a fluorescein-conjugated chitin-binding probe (1:200; NEB P5211S) was applied ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: Polymerase chain reaction (PCR) of constructs utilized for plasmid assembly were amplified by NEB Q5 Hot-Start 2X Mastermix according to the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Interacting MBP-AtPIP5K2 protein was detected using an anti-MBP antibody (NEB). Protein input was detected using an anti-GST antibody (GE Healthcare).
-
bioRxiv - Microbiology 2022Quote: Escherichia coli DNA adenine methyltransferase (dam)+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/dcm− (dam−/dcm− competent E ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli 5-alpha and purified using the Monarch Plasmid Miniprep Kit (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... The assembly reaction was transformed into NEB 5-alpha competent cells (New England Biolabs). After the recovery step ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Constructed plasmids were transformed and maintained in NEB 5-alpha (New England Biolabs (NEB) C2987H ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transformations used the NEB recommended protocols for chemical transformation (NEB 5-alpha, Cat# C2987H) or electroporation (NEB 10-beta ...
-
bioRxiv - Microbiology 2021Quote: ... using a 12-µL Gibson Assembly (GA) reaction (purchased from NEB or prepared in house) by incubation at 50°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Immunology 2020Quote: Heavy and light chain vectors were verified by sequencing and transformed into DH5alpha cells (NEB). The transformed cells were grown and the plasmid was purified by midiprep (Macherey-Nagel) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Microbiology 2024Quote: ... Polymerase chain reaction was carried out using Q5 high-fidelity polymerase (New England Biolabs, UK) for cloning or AppTaq RedMix (Appleton Woods ...
-
bioRxiv - Cell Biology 2024Quote: Human ARHGAP18 constructs were produced using polymerase chain reaction (PCR) with New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (Cat# E0553L) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli using standard transformation techniques with NEB 5-Alpha chemically competent cells (New England BioLabs), and to C ...
-
bioRxiv - Synthetic Biology 2023Quote: All cloning was performed in NEB 5-alpha Competent Escherichia coli (New England BioLabs C2987U). The Pseudomonas putida KT2440 strain was purchased from ATCC (#47054) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The assembled plasmid was introduced into Escherichia coli strain NEB 5-alpha (New England Biolabs) by heat shocking ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were amplified in chemically competent 5-alpha F’Iq Escherichia coli cells (New England Biolabs) after 42°C heat shock transformation and extracted using the GenElute HP Plasmid Miniprep Kit (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmids were chemically transformed into DH5-alpha cells (cat no. C2987, New England Biolabs Inc.) and plated on agar plates containing appropriate antibiotics ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB, Cat# C2992H) and extracted using the PureYield Plasmid Miniprep System (Promega ...
-
bioRxiv - Genetics 2024Quote: All plasmids were transformed into NEB 5-alpha Competent Escherichia coli cells (New England Biolabs) and purified using Qiaprep Spin Miniprep Kits or Plasmid Plus Maxi Kits for plasmid libraries (QIAGEN) ...
-
bioRxiv - Biophysics 2024Quote: ... The ligation mix was then transformed into NEB 5-alpha competent cells (NEB, Cat. # C2987H) and colonies were selected using 50 µg/mL Kanamycin LB agar plate ...
-
bioRxiv - Systems Biology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again with a GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... The polymerase chain reaction (PCR) was performed with “Taq DNA Polymerase with Standard Taq Buffer” (NEB) according to company’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 18ng heavy or light chain fragment and 10ul of Gibson assembly master mix (New England Biolabs). 5-alpha competent E ...