Labshake search
Citations for New England Biolabs :
151 - 200 of 1738 citations for 7 NITRO 3 4 DIHYDROISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Zoology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Plant Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL CutSmart buffer (New England Biolabs), 20 μL DNA solution (50 ng total DNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Pathology 2021Quote: ... 3 µL of DNAse I (NEB, USA) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μl ThermoPol Buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 3 μL DNase I (NEB), 3 μL 10xDNase I Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Pathology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of DNA was mixed with 7 µl NEBNext Ultra II end prep reaction buffer (NEB) and 3 µl Ultra II end prep enzyme mix (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 U of SssI (NEB) or 4 µl purified Eco72IM (diluted 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... in 1X NEBbuffer 4 (NEB #B7004), or an equivalent volume of ultra-pure water and 1X NEBbuffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl Klenow fragment (NEB M0212L) and 10 μl 10 nM dATP 20 min at 37 °C and 20 min at 75°C to inactivate the reaction ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10xG7 Buffer (NEB), 4 μl of 10% NP-40 (NEB ...
-
bioRxiv - Pathology 2019Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2019Quote: ... 4 µL Murine RNase inhibitor (NEB), 1 µL T7 polymerase (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...