Labshake search
Citations for New England Biolabs :
1 - 50 of 1738 citations for 7 NITRO 3 4 DIHYDROISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Microbiology 2022Quote: ... and exon 7 (BSErI, NEB). PCR amplicons were also purified with MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Genomics 2023Quote: ... 7 μL Q5 high GC enhancer (NEB), 0.07 μL 100mM dATP ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 7 μl Polynucleotide Kinase (10 U/µl; NEB) in a total of 100 μl and incubation for 20 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL Murine RNase Inhibitor (New England Biolabs, M0314) was added ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genetics 2019Quote: ... in 7 ml of ligation cocktail including 1.1 × ligation buffer (NEB) and 10% Triton X-100 for 2 hours at 16°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Genomics 2021Quote: ... 7 μL 20 μg/μL proteinase K (New England Biolabs P8107) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...