Labshake search
Citations for New England Biolabs :
151 - 200 of 3700 citations for 6 Propyl 2 thioxo 2 3 dihydropyrimidin 4 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL T4 ligase buffer (NEB), 1 μL BsmBI restriction enzyme (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB) or 10 units of HpaII (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB), to assess the methylation status of two CpG sites in the promoter region ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and Cap 2’-O-Methyltransferase (NEB), followed by another purification by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL of USER enzyme (NEB) was added directly to each purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 U DNAse I (NEB). Then sonicated on ice for 10 sec and boiled 15’ at 99°C after adding 25 μL of SDS-PAGE 5x loading buffer and resolved by SDS-PAGE ...
-
bioRxiv - Genomics 2019Quote: ... 2 µl of USER enzyme (NEB) was added to the purified assembly reactions and incubated at 37 °C for 15 minutes followed by 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µl Endo H (NEB P0702S) and 3 µl of G3 reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...