Labshake search
Citations for New England Biolabs :
1 - 50 of 3700 citations for 6 Propyl 2 thioxo 2 3 dihydropyrimidin 4 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4 μl T4 RNA ligase 2 (NEB, catalog no. M0239) for 16 hours at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2 ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...