Labshake search
Citations for New England Biolabs :
151 - 200 of 4951 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 5:1 molar ratio of insert to backbone and 1X Gibson Assembly Master Mix (NEB) and incubated at 50°C for 1 hour before transformation into One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Biochemistry 2020Quote: ... 5:1 molar ratio of insert to backbone and 1X Gibson Assembly Master Mix (NEB) and incubated at 50°C for 1 hour before transformation into One Shot TOP10 Chemically Competent E ...
-
bioRxiv - Microbiology 2020Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs; 0.01 units/μL), Taq DNA ligase (New England BioLabs ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μl of 2x Quick Ligase buffer and 1 μl of Quick ligase (NEB, M2200) in a final volume of 10 μl was incubated for 10 min at RT and then used to transform DH5α competent cells ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.01% Igepal CA-630 and 5% glycerol) with 1 U/µL murine RNase inhibitor (NEB), 0.1 µg/µL T7 RNA polymerase (purified in-house ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... the isolated RNA was treated with 1 μl (5 units) RppH enzyme (New England Biolabs) in NEB Buffer 2 (50 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 μl of the reaction with 1 μl of loading dye (New England Biolabs). Agarose gel was electrophoresed at 70V until resolution of bands required was reached ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the random primer method (Random Primer 6, NEB S1230S ...
-
bioRxiv - Biochemistry 2019Quote: ... and terminated by adding 6× DNA loading buffer (NEB). For cleavage assay presented in Figs ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... The pet30-B vector was digested with Nde1 (R0111, New England BioLabs, Waltham, MA) and EcoRI-HF (R3101 New England BioLabs ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this was then combined with 5 μL Q5 buffer (NEB, cat#M0491 S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Genomics 2020Quote: ... each eluted insert was mixed with 50ng pDXinit-PAC in a molar ratio of 1:5 (vector:insert) in 10μl reactions and digested with 0.5μl SapI (NEB) for 1h at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 40 nM down primer and 5 μM dNTP in 17 μl 1 x CutSmart buffer (NEB). The RNA and primers were incubated at a temperature gradient ...
-
bioRxiv - Molecular Biology 2023Quote: ... These were eluted and precipitated before ligation to 5’ adapters (1× T4 RNA ligase buffer (NEB), 0.5 µM p10IllLigup adapter ...
-
bioRxiv - Plant Biology 2022Quote: ... We then ligated single-stranded rP5_RND adapters to 5’-ends with T4 RNA ligase 1 (NEB). Ligated RNAs were enriched and captured by oligo(dT ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 µL of 20 mg/mL BSA (New England Biolabs) and 3.5 µL of 5 Weiss U/µL T4 DNA Ligase (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was applied to 6 ml amylose resin (NEB) at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 6 U SalI (New England Biolabs, Cat. No. R0138S)) were incubated with the following condition ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μL of Taq Buffer B (Mg-free; 10X) (New England Biolabs, Ipswich, MA, USA), 2.5 μL of dNTPs (2.5 mM of each base) ...
-
bioRxiv - Bioengineering 2023Quote: These inserts were then cloned into the pSECRETS-B cassette via USER cloning (NEB #M5505S). To maintain library diversity ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and then added up to 5 fmol DNA (2000:1000:1 RNA:protein:DNA ratio) and NEBuffer 3.1 (NEB) to 1X ...