Labshake search
Citations for New England Biolabs :
1 - 50 of 4951 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL 20mg/ml BSA and 5 μL 400U/μl T4 DNA Ligase (NEB, M0202) overnight at 16°C (tumbling ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Biophysics 2021Quote: ... coli B ER2566 from NEB; ampicillin ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 5 µM RA3 adapter (NEB) was added to 5 µL RNA sample ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The coding and reverse oligonucleotides were mixed (6 µL H2O, 1 µL T4 Ligase Buffer, 1 µL T4 PNK (10 U/µL; NEB), 1 µL of each 100 µM oligonucleotide ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L). The resulting RNA fragments were used for a reverse transcription reaction using Superscript III Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 5 units/µl RNase H (NEB) were added and samples were incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL RNase H enzyme (5 U) (New England Biolabs) was added and the solution was incubated at 44°C for 1 hr ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μL of PaqCI/AarI activator (5 pmol, NEB, S0532S), 1 μL of 10 U PaqCI/AarI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were resuspended in 1 ml of iCLIP lysis buffer B (same as buffer A but with 1% v/v NP-40 and 11 μl of Murine RNase inhibitor (NEB) per 1 ml ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...