Labshake search
Citations for New England Biolabs :
1901 - 1950 of 2005 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ termini of all ten DNA fragments (F1-F9 and the linker) were phosphorylated by using T4 PNK (NEB; #M0201), and the equimolar amounts (0.05 pmol each ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M) overnight on a shaking thermomixer ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µl of 100 µM barcode-linked oligo-dT primer was added to each well with 5 µl of 5x ProtoScript RT buffer (New England Biolabs M0368). The plate was incubated at 94°C for 2 min and immediately cooled on ice for at least 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were constructed using the NEBNext Ultra II directional RNA library preparation kit for Illumina according to the protocol for purified mRNA or ribosome-depleted RNA and with a 5-min RNA fragmentation step (NEB E7760). Library PCRs were supplemented with 2× SYBR dye (Sigma S9430 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation a UDG-treatment was performed using 16.25ul of purified DNA and 5 μl (1U/1uL) USER enzyme (New England BioLabs®, Inc.) and an incubation of 3 hours at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2x 1-5 µg of DNA were adaptor ligated and indexed using the NEBNext DNA library Prep Reagent Set (New England Biolabs: E6040S/L) and NEBNext Multiplex Oligos for Illumina Primer sets 1 (New England ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell lysates were adjusted to the same protein concentration using furin cleavage buffer (100 mM Tris-HCL and 1mM CaCl2) and incubated with 5 units of Furin (NEB, Ipswich, MA) for 16 h at 30℃ ...
-
bioRxiv - Microbiology 2022Quote: ... colony PCR was conducted to amplify the 5’ IGR of the major T6 cluster using OneTaq DNA Polymerase (New England Biolabs – MA, USA). PCR products were confirmed with gel electrophoresis and Sanger sequencing by Eton Bioscience Inc ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Plant Biology 2021Quote: ... 500 ng of the SAP-treated RNA was treated with 12.5 units RNA 5’ Pyrophophohydrolase (RppH; New England BioLabs; Ipswitch, MA, USA) in 1X T4 RNA Ligase Buffer (New England BioLabs ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Genetics 2019Quote: ... 2× 1-5 µg of DNA were adaptor ligated and indexed using the NEBNext DNA library Prep Reagent Set (New England Biolabs: E6040S/L) and NEBNext Multiplex Oligos for Illumina Primer sets 1 (New England ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µl of template, 20 U of exonuclease I, 5 U of Antarctic phosphatase, 1× Antarctic phosphatase buffer; New England Biolabs, Frankfurt, Germany); incubation conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...