Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2005 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of each sublibrary plasmid was digested at 37°C for 5 hours with NheI-HF and SacI-HF (New England Biolabs), incubated with rSAP for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Molecular Biology 2024Quote: ... AlkB D135S and AlkB D135S/L118V were mixed and incubated with 1 pmol of a synthetic RNA oligonucleotide carrying m1A or m1G at the 5’-end (m1AUGCACUUGGACGAACCAGAGUGUAGCUUAA, IBA Sciences; m1GGCGCAGCGGAAGCGUGCUGGGCCCA, kindly provided by R. Micura) previously 32P-labelled with T4 PNK (NEB), and 500 ng total RNA extracted from HAP1 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Neuroscience 2024Quote: ... the tissue was incubated in 5 mL of a clearing solution comprising Clearing Premix (Vizgen, PN 20300003) and 50 μL Proteinase K (New England BioLabs) at 37°C in a humidified benchtop incubator until the tissue was cleared.
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Base editing sgRNA directed against the SF3B1 K700 locus was designed using BE-Designer28 and cloned into pLKO.5 Puro-2A-GFP between BsmBI (New England Biolabs) cut sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... the hU6-pegRNA2-polyT cassette was amplified from the pU6-pegRNA-gg-acceptor backbone and ligated into ngRNA1 pLKO.5 Puro-2A-RFP between EcoRI and XhoI (New England Biolabs) to create pLKO.5-K700E-ng1+pg2-Puro-2A-RFP ...
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... 120 µL 10x T4 DNA ligase buffer and 5 µL of 400 U/µL T4 DNA ligase (New England Biolabs) was added ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Biochemistry 2024Quote: ... GoldenGate reactions were performed with 5 U of restriction enzyme and 200 U of T4 ligase in T4 ligase buffer (NEB) also containing 0.1 mg/ml BSA (NEB ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each of the synthesized DNA fragments was amplified by PCR and inserted at the 5’ of the GFP gene in the pPha-NR vector (NovoPro Bioscience) using NEBuilder HiFi DNA Assembly (New England BioLabs). Five μg of the pPha-NR constructs were introduced into P ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...