Labshake search
Citations for New England Biolabs :
1851 - 1900 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 µL reaction volume contained 2.5 µL Luna® Universal qPCR mastermix (NEB). RT-qPCR analyses were performed using the Real-time PCR Roche Lightcycler 480 and the expression of PP2AA3 (At1G13320 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT) or 5 units of RNASEH1 enzyme (M0297, New England Biolabs) for 30 mins at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Trypsin digestion was stopped by adding 5% BSA (ref. B9000S, New England Biolabs) and the cell suspension was passed through a 40 µm Flowmi cell strainer (ref ...
-
bioRxiv - Cell Biology 2023Quote: ... EcoRI and XbaI 5’ overhangs were filled in with dGTP (New England Biolabs), dCTP (New England Biolabs) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 72°C for 5 min) (Phusion High-Fidelity DNA Polymerase, NEB, M0530S) using the P7 and a T7-fused P5 primer (5′ TAA TAC GAC TCA CTA TAG GGA ATG ATA CGG CGA CCA CCG A 3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2024Quote: ... and then ligated to cDNA using Thermostable 5’ App DNA/RNA Ligase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM BME) onto a 10 ml amylose column (New England Biolabs). The amylose column was washed with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB) and checked on 1% agarose gel and approximately 600 ng of each PCR product was used as template for in vitro dsRNA synthesis according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were mixed with Hydrophilic Streptavidin Magnetic Beads (5 µl) (NEB #S1421S) and binding buffer (500 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was degraded with 5 units of each RNase H (BioLabs cat #M029L) and RNase A/T1 (Thermo Scientific cat #EN0551) ...
-
bioRxiv - Biophysics 2024Quote: ... PM187B20 was 5’ end labelled using 1 μL T4 polynucleotide Kinase (NEB, M0201S), 1 μL γ 32P ATP (Perkin Elmer ...
-
bioRxiv - Genomics 2024Quote: ... 5 units of PolyA polymerase (E. coli or yeast as appropriate) (NEB#M0276S). The reaction was incubated at 37°C for either 7 or 30 minutes and stopped by purification with a MEGAclear column (Termofisher AM1908 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Bioengineering 2024Quote: ... phosphorylated at the 5’ ends with T4 polynucleotide kinase (New England Biolabs M0201), annealed to generate a double-stranded insert ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Bioengineering 2024Quote: ... Tagmentation reactions were halted using 5 µL of a 50% proteinase K (NEB) solution (mixed with H2O ...
-
bioRxiv - Bioengineering 2024Quote: ... Tagmentation reactions were halted using 5 µL of a 50% proteinase K (NEB) solution (mixed with H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... The initial 5 cycles of PCR were performed using Q5 polymerase (NEB M0491), 200uM dNTPs (Invitrogen 10297-018 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 μl Klenow fragment (3′ to 5′ exo-, Cat. #M0212L; New England Biolabs) and 0.5 μl T4 Polynucleotide Kinase (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... the pHRRA1-GFP (pKS85) (Table 4) plasmid was PCR-amplified with Phusion HF Polymerase (NEB), using primers designed using the QuikChange Primer Design tool (Agilent) ...
-
bioRxiv - Immunology 2022Quote: The I53-50A and I53-50B.4.PT1 proteins26 were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Bioengineering 2020Quote: The following components comprised the RT-LAMP assay: 4 mM of MgSO4 (New England Biolabs), 1× final concentration of the isothermal amplification buffer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Genomics 2021Quote: ... the following were added into each reaction tube: 0.5 μL of 10x buffer 4 (NEB), 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB) ...
-
bioRxiv - Immunology 2020Quote: The I53-50A and I53-50B.4.PT1 proteins were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Cancer Biology 2021Quote: ... the PCR product was incubated for 4 hours with 2uL DpnI (NEB, Cat. No R0176), at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second strand was synthesized with 4 U of T7 DNA polymerase (New England BioLabs) and purified with HighPrep PCR beads (MagBio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the fragments were ligated over night at 4°C with T4 DNA Ligase (NEB) and heat shock transformed into DH5α competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250ng of genomic DNA was digested with the 4-base cutter MnlI (NEB, Ipswich, MA), overnight at 37°C according to manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... Frozen cell pellets were resuspended in 4 mL of IMAC buffer (NEB, Ipswich, MA, USA) on ice and dispersed using an ultrasonic disruptor (Sonics ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Microbiology 2022Quote: ... PCR master mix reagents (see Figure 4): Taq polymerase and 10X Reaction Buffer (NEB M0273S), nucleotide mix containing 10 mM dTTP ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Genetics 2024Quote: ... homology arms were PCR amplified and cloned by a 4-fragment Gibson assembly (NEB E2621S) within the loxP-Blasticidin-HSVTK-loxP-TetOx96 and CuOx150-FRT-Neomycin-FRT plasmids73 ...
-
bioRxiv - Immunology 2024Quote: ... Purified RNA was treated with 4 units of DNase I (1µL/unit) (NEB, Cat. # M0303) for 1 hour at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... USA) and used to generate sequences with the desired amino acid substitution using Q5 Site-Directed Mutagenesis Kit (NEB, via BioTek, Praha, Czech Republic). Primers were designed using NEBaseChanger (https://nebasechanger.neb.com/) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...