Labshake search
Citations for New England Biolabs :
1851 - 1900 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... One microlitre of T4 DNA ligase (NEB, 400,000U/mL) was added to the reaction and incubated at 16 °C to ligate inserts ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... or Luna Universal One-Step RT-qPCR Kit (NEB) and 1.5 μl of reference primer/probe sets CDC-N1 (IDT 10006713 ...
-
bioRxiv - Immunology 2021Quote: ... directly into One Step RT-PCR reaction mix (NEB) loaded in MicroAmp Optical 96-well reaction plates (Applied Biosystems) ...
-
bioRxiv - Genetics 2022Quote: ... was digested for one hour with 50 DpnI (NEB) units to eliminate unreplicated plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... One mL of amylose resine (E8021S, New England Biolabs) was poured into a 1.5 x 10 cm column ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... in an all-in-one T7 ligase (NEB#M0318S) based Golden-Gate assembly (37° C for 5min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... One is to use the restriction enzyme PmlI (NEB) to cut circular plasmids by incubation at 37°C for 2 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genomics 2019Quote: ... The adapter ligated DNA fragments were deaminated by the enzymatic deamination method using Enzymatic Methyl-seq Conversion Module (NEB, E7125) or by sodium bisulfite using two commercially available kits ...
-
bioRxiv - Genomics 2021Quote: ... C and 5mC deamination reaction was performed using the APOBEC3A enzyme (NEBNext® Enzymatic Methyl-seq Kit, New England Biolabs) with the following ramping conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated to barcoded adapters (xGen Methyl UDI-UMI Adapters, Integrated DNA Technologies) using concentrated T4 ligase (New England Biolabs) at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each pool was then converted using an enzyme-based conversion to increase the recovery of single cell gDNA compared to standard bisulfite conversion (NEBNext Enzymatic Methyl-seq, New England Biolabs)102 ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Immunology 2022Quote: ... Viral RNA was quantified using a one-step RT qPCR reaction with the NEB Luna Universal Probe One-Step RT-qPCR (New England Biolabs, Ipswich, MA, USA) and the 2019-nCoV RT-qPCR primers and probe (E_Sarbeco)84 on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription and quantitative PCR were performed in one step using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA). The primers used are listed in supplemental table (Table ...
-
bioRxiv - Microbiology 2019Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Genetics 2020Quote: ... Only 1 U/μl I-SceI enzyme 5 X/μl buffer (NEB) were mixed when co-injecting with the HDR donor ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL of 2-Log DNA Ladder (200 μg/mL; NEB) is mixed with 1 μL of Gel Loading Dye (6x ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 1 mg/ml bovine serum albumin solution (NEB), 1 μL of hOGG1 (ProSpec TechnoGene Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... 1–2 mg of RNA was treated with DNAse I (NEB), x µL and 2 µL of this reaction was used to make cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ul of micrococcal nuclease (Biolabs M02475, 2×106 U/ml) was added to 200 μl buffer containing 1 mM CaCl2 and incubated for 10 min 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1× LongAmp® Taq 2× Master Mix (New England Biolabs, UK), and 2 μL of a unique barcode ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...