Labshake search
Citations for New England Biolabs :
1701 - 1750 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: pBGC24 was used to construct pBGA by exchanging the cat gene (chloramphenicol resistance) with aac(3)-IV (apramycin resistance) from pMDIAI31 by Gibson assembly (New England Biolabs, UK). pLC10-Apra was constructed by exchanging the aph(3’)-Ia gene (Kanamycin resistance ...
-
bioRxiv - Cell Biology 2019Quote: ... The 5’ end and the 3’ UTR amplicons were cloned in the pmEGFP-Neo4 vector (Briguglio et al., 2013) by Quick Ligation (New England, Biolabs Inc.) at SacI/NheI and XhoI/ApaI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting amplicon was assembled with a hHBB-Nluc sequence that lacked a 3’ UTR but maintained a unique barcode using a NEBuilder HiFi Assembly Kit (NEB, ES2621).
-
bioRxiv - Cell Biology 2020Quote: Three point mutations in the predicted miR-145 seed binding site in DUSP6 were introduced in pGEM-T-DUSP6 3’UTR using a Phusion® site-directed mutagenesis kit (NEB) and the mutagenic primers ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Genetics 2021Quote: ... the RNP complex was assembled by incubating 9 μL of guide RNA with 3 μL of nuclease in 12 μL of nuclease-free H2O with 3 μL of 10x Cas9 reaction buffer (New England Biolabs, #B0386) at 37 °C for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... and ChCEC6 were amplified using primers listed in Supplementary Table 3 and Phusion® High-Fidelity DNA Polymerase (New England Biolabs), then cloned into pCR8/GW/TOPO (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... The 3-part assembly reaction (plasmid-promoter-insert) was performed using the Gibson assembly master mix 2x (New England Biolabs #E2611S), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Digestion into nucleosides was carried out on 3 μg aliquots using ‘nucleoside digestion enzyme mix’ from New England Biolabs (NEB#M0649) and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Sox2 promoter was cloned by first removing the Ef1a promoter from the 3-SB-EF1-PBBAR-SB vector using NdeI (NEB, R0111) and SalI (NEB ...
-
bioRxiv - Genomics 2022Quote: ... PX458 and the synthetized SapI sgRNA expression cassette (IDT, find sequence in Table 3) were digested with KpnI (New England Biolabs, R3142S). Next ...
-
bioRxiv - Microbiology 2022Quote: ... Assembly of the two cDNA fragments was done using five overlapping cDNA fragments containing the VOC lineage defining mutations and replicon specific gene replacements (see Supplementary Table 3) using a NEBuilder® HiFi DNA Assembly Master Mix (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... and pre-amplified for 14 cycles against a pool of primers (Supplemental Table 3) using PreAmp Grandmaster mix (TATAA Biocenter, Sweden #TA05) before exonuclease I treatment (New England Biolabs #M0293L). Pre-amplified cDNA was diluted at least 5-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad #1725211 ...
-
bioRxiv - Genomics 2022Quote: ... Looped adapter sequences were opened by removal of uracil from hairpin structures by adding 3 units of USER enzyme (Uracil-Specific Excision Reagent) (NEB, M5505S) and incubation at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Biochemistry 2023Quote: ... and ATF4 5ʹ UTR-nLuc-3XFLAG mRNAs were co-transcriptionally capped with the 3’-O-Me-m7G(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1411S). All viral IRES nLuc-3XFLAG mRNAs were co-transcriptionally capped with the A(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1406S).
-
bioRxiv - Developmental Biology 2023Quote: ... and a capture sequence at the scaffold of sgRNA for 10x feature barcode retrieval (cs1 incorporated at the 3’ end; (Replogle et al., 2020)) with use of NEBuilder HiFi DNA Assembly (NEB, E2621). sgRNAs were designed using CRISPick for CRISPRko (Doench et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... we introduced a silent mutation into the PAM motif of the sgRNA located within the 3’ homology arm in the donor plasmid by using Q5 Site-Directed Mutagenesis kit (NEB, E0054). The donor plasmid was confirmed with DNA sequencing ...
-
bioRxiv - Genomics 2022Quote: ... Approximately 3 μg of input DNA was dephosphorylated with alkaline phosphatase (ONT, cat SQK-CS9109) in CutSmart Buffer (NEB, cat B7204). Following enzyme inactivation of alkaline phosphatase ...
-
bioRxiv - Cell Biology 2022Quote: ... stop codon and 3’ T7 terminator were used as templates for the coupled in vitro transcription/translation PURExpress system (New England Biolabs, USA). The various SQS constructs used for cysteine crosslinking comprised an N-terminal 3xFLAG tag ...
-
bioRxiv - Microbiology 2023Quote: ... The 2X FLAG sequence was introduced via PCR as an oligonucleotide primer along with a reverse primer that produced the 3’ CNA1 UTR and cloned by use of the Gibson Assembly Cloning Kit (NEB #E5510S). The identity of the vector pCnat-CNA1-2X FLAG was also confirmed by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Systems Biology 2023Quote: ... 3) the wt bZIP sequences by digesting them out of them original plasmids with BamHI-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... The transgene and sex of the F0 and F1 pups were determined by 3 PCRs of the Y chromosome using oligonucleotides described in Table S2 and LongAmp DNA polymerase (New England Biolabs, USA). Thermocycling conditions were as follows ...
-
bioRxiv - Genetics 2023Quote: ... n=16 ligations were performed using 300 ng of digested and dephosphorylated Trono-BR backbone and 3 ng of digested insert with high concentration T4 DNA Ligase (NEB #M0202M). The ligation reactions were precipitated using QuantaBio 5PRIME Phase Lock Gel tubes before being resuspended in 3 µL of EB Buffer per 4 precipitated reactions ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix, NEB #E2621). The U6 promotor and the invariant scaffold are separated by a unique BsmBI restriction site using Q5® Site-Directed Mutagenesis Kit (NEB #E0554) ...
-
bioRxiv - Cancer Biology 2023Quote: ... McGill University) and used to replace the mTurquoise of constructed 14-3-3ζ-mTurquoise using AgeI and NotI-HF (NEB; # R3189S). To conjugate Rluc8 to the N-termini of 14-3-3ζ ...
-
bioRxiv - Cell Biology 2023Quote: ... 5′-Phos-GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGUU[Biotin-dT]U[Biotin-dT]UUACACTCTTTCCCTACACGACGCTCTTCCGATC∗T-3′[∗phosphorothioate bond]) was then ligated at the free DSB ends with the quick ligase enzyme (NEB; M2200). After the primer ligation ...
-
bioRxiv - Microbiology 2023Quote: ... A 3x HA-tag was fused to the C-terminal region of the amplified product along with the 3’UTR formed through Gibson assembly master mix (NEB, E2611S). To generate the PfMORC-HA knockdown constructs ...
-
bioRxiv - Plant Biology 2024Quote: ... and PE 2.0 (5′-CAA GCA GAA GAC GGC ATA CGA GAT CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC* T-3′) for 15 cycles using Phusion polymerase (NEB M0530S). The library was purified by electrophoresis on a 1.2% agarose gel to get rid of adapter dimers ...
-
bioRxiv - Cell Biology 2024Quote: ... The pRNA destination backbone was linearised by primers s5 and s6 (Table 3) and assembled with the mScarlet-I3 fragment using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pRNA-mScarlet-I3 destination vector ...
-
bioRxiv - Genomics 2021Quote: ... One microliter of QuickCIP (New England Biolabs) was added and the solution was incubated at 37 °C for 10 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One microliter of T7 endonuclease Ⅰ (NEB) was added to the sample ...
-
bioRxiv - Bioengineering 2022Quote: ... and one with BseYI (NEB cat# R0635S) according to manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pulse labelled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4 µM final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constructs were subjected to treatment with NEBNext® Enzymatic Methyl-seq (EM-seq™) (NEB, #E7125) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs) were added to improve the efficiency of the reaction ...
-
bioRxiv - Genetics 2023Quote: ... Enzymatic conversion was performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England BioLabs, Cat#E7125S) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The coding and reverse oligonucleotides were mixed (6 µL H2O, 1 µL T4 Ligase Buffer, 1 µL T4 PNK (10 U/µL; NEB), 1 µL of each 100 µM oligonucleotide ...
-
bioRxiv - Bioengineering 2022Quote: One μL of amplicons from colony PCR is mixed with 1 μL of Gel Loading Dye (6x; NEB) and 4 μL of nuclease-free water in each well on the 1.2% agarose gel (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...