Labshake search
Citations for New England Biolabs :
1801 - 1850 of 2109 citations for 6 Benzofurancarboxamide N 2 azabicyclo 2.2.1 hept 6 yl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were boiled for 10 min and 2 μL of 20 mg/ml proteinase K (New England Biolabs, Cat. #P8107S) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Cell Biology 2023Quote: ... the repair vector GW209_pCRIS-PITChv2-C-dTAG-Puro (BRD4) (2 μg) was digested with MluI-HF (New England Biolabs; #R3198) in Cutsmart Buffer for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... The 2 pairs of ends were then ligated simultaneously to the linearized plasmid using T4 DNA Ligase (New England Biolabs:M0202) at 2 U/pmol DNA ends in 1x T4 ligase buffer (provided with enzyme) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... the region containing the target surrounded by the context was amplified by PCR using primers P7-P8 with Q5 Hot Start High-Fidelity 2× Master Mix (NEB) with the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... ninety-six 20 μl ePCR reactions were performed using 0.01 fmol of pooled oligos with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S). Each 20 μl PCR mix was combined with 40 μl of oil-surfactant mixture (containing 4.5 % Span 80 (v/v) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 22 µL of ligation mix (20 µL quick ligase buffer and 2 µL of quick ligase, NEB) and incubation at 25°C for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl preramp PCR product was mixed with 48 µl tagging PCR mix (10 µl 5x phusion HF buffer (NEB); 1 µl Phusion Hot Start II DNA Polymerase (2U/ µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Genomics 2023Quote: ... were PCR-amplified (2 PCR reactions, 12 cycles) using Illumina adapter-specific primers and NEBNext Ultra II Q5 Master Mix (NEB). After library profile analysis by Agilent 2100 Bioanalyser (Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and amplified using NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 2, New England Biolabs, #E6442). After quality check with the Bioanalyzer High Sensitivity DNA assay (Agilent) ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mix (2 μL) was then used to transform 25 μL of chemically competent 10-beta cells (C3019H; NEB), which were subsequently plated on Luria-Bertani (LB ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was isolated from total RNA or crude cell lysates by 2 rounds of affinity chromatography using oligo d(T)25-derivatized magnetic beads (NEB). RNA yields were quantified by ultraviolet (UV ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Genetics 2023Quote: ... we treated the glands with 0.1% Triton X-100 for 2 minutes prior to adding 100 ug/mL RNase A (NEB #T3018L) and performed a 1 hour incubation at RT (24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were treated with DNase I (20 units) in the presence of RNase inhibitor at 300 U/ml in x1 buffer # 2 (NEB) at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 mg of small RNA from the 12 diverse organs/tissues was resuspended in 10 mL of 1x GlycoBuffer 2 (NEB) and 7.5 mL PNGaseF (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell pellets were lysed directly in 8X the cell pellet volume with 2% SDS blue loading buffer (New England Biolabs), containing DTT ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Biophysics 2023Quote: ... primers with overlapping sequences (Supplementary Tables 1 and 2) were designed to generate point mutations with the NEBuilder HiFi DNA Assembly mix (New England Biolabs). Wild-type protein expression was performed in OverExpress C41 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNA amplicons were generated by PCR of 2 ug genomic DNA per 100 ul reaction with Q5 2X Hot Start Master Mix (M0494L, NEB) and enough reactions to maintain 1000x screening sgRNA representation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cosmids were then digested for 2 hours at 37°C and heat-inactivated for 20 minutes at 80°C using SpeI-HF (New England Biolabs). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... They were inserted into the linearized vector of pRVΔG-4mCherry from step 2 described above using HiFi DNA Assembly (NEB, USA). The HiFi reaction was mixed as described below:
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Molecular Biology 2023Quote: The miRCat-33 3’ linker was ligated to the 3’ end of the RNAs on the Ni-NTA beads with 800 units of T4 RNA ligase 2 truncated K227Q (New England Biolabs) in 1 x PNK buffer / 16.67% PEG 8000 in the presence of 80 units RNasin in a total volume of 80 µl ...
-
bioRxiv - Genomics 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...