Labshake search
Citations for New England Biolabs :
1751 - 1800 of 2459 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Neuroscience 2022Quote: ... Supplementary Table 4) from each sample was further processed with the Illumina NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7760S/L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... or medium that were pulled down with heparin-agarose (0.5 ml) were denatured and incubated with Arthrobacter ureafaciens sialidase (Nacalai Tesque, 4 milliunits) and/or O-glycosidase (New England BioLabs, 80,000 units), or peptide N-glycanase (PNGase ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Qiagen protocol 4 was followed for enzymatic lysis with lysozyme (DOT Scientific catalog #DSL38100) and 20 µL proteinase K (NEB catalog #P8107S). Qiagen protocol 7 was followed for RNA purification including DNase I digestion on-column (Qiagen catalog# 79254) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Biophysics 2023Quote: ... linker (listed in Supplemental Table S6) was ligated to the 3′ end using T4 RNA Ligase 2 truncated KQ (New England Biolabs #M0373, 400 units per sample) in T4 Ligase reaction buffer (New England Biolabs #B0216 ...
-
bioRxiv - Bioengineering 2019Quote: ... Poly-d(T) beads (NEB #S1419S) were washed twice with 100 μL wash and bind buffer (20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Genomics 2020Quote: ... oligo d(T)23VN primer (NEB) was annealed to template RNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR mixture was incubated with one-unit DpnI (NEB) for 1h at 37°C in a final volume of 40 uL to remove E ...
-
bioRxiv - Cancer Biology 2022Quote: ... or one gBlock for SOCS1 (IDT) by Gibson assembly (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Luna Universal One-Step RT-qPCR kit (New England Biolabs) was used following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: One unit of RNA polymerase Core Enzyme (New England Biolabs) was added reconstituted with 1 μg of purified recombinant αS (vendor ...
-
bioRxiv - Microbiology 2022Quote: ... Luna® Universal One-Step RT-qPCR Kit from NEB was used for RT-qPCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplification using Luna One Step qPCR mix with UDG (NEB) that did not contain a reverse transcriptase component (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used One Taq Hot Start Polymerase (New England Biolabs), 94°C 30 sec ...
-
bioRxiv - Molecular Biology 2023Quote: ... One part of RNA was treated with T4 PNK (NEB) in a reaction buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... One half was treated with Lambda phosphatase and MnCl2 (NEB), the other half was treated with MnCl2 only ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Developmental Biology 2024Quote: ... system following the manufacturer’s instruction with one additional DNAse (NEB) treatment step ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digests with 6 x loading dye (NEB) were run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6 μl CutSmart Buffer (NEB, B7204) in a total volume of 60 μl for 3 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 U Bst3.0 DNA polymerase (NEB) in total 15 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... 6 mM MgSO4 (NEB, final 8mM Mg2+), 1.4 mM each dNTP (Enzynomics) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... Genes of interest were cloned to Gateway™ pENTR™ 4 Dual Selection Vector (A10465) by NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L) and cloned to a pUC19 expression vector powered by the maize ubiquitin promoter (ZmUBI ...
-
bioRxiv - Microbiology 2021Quote: ... 50 pmol Oligo d(T)23 (NEB) and 10 pmol Deoxynucleotide Triphosphate Mix (Promega) ...