Labshake search
Citations for New England Biolabs :
1751 - 1800 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... SIVsmm Vpr and Nef expression constructs were described before20,51 Chimeric HIV-2 and SIVsmm infectious molecular clones as well as CG mutants thereof were generated using Gibson assembly (NEB) and cloned into pCR XL TOPO or pBR vector using NotI/MluI restriction sites using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... For screens in the VAND and VEG strains a novel vector pCas9-GFP-DHFR-TS::sgRNA was created by Gibson cloning the DHFR-TS selection cassette amplified with primers 1-2 from the template GRAx-TGGT1-069070-DHFR-TS in pCas9-GFP-HXGPRT::sgRNA double-digested with SmaI/EcoRI (NEB). PCRs were performed with the proof-reading polymerase KOD (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: Plasmids (Supplementary Table 2) were purified from overnight bacterial cultures using the Monarch Plasmid Miniprep Kit (New England Biolabs, UK). Polymerase chain reaction was carried out using Q5 high-fidelity polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... All others cloning were classically performed by vector and PCR products restriction for 2 hours at 37°C in Cutsmart Buffer (New England Biolabs) with appropriate restrictions enzymes (BamHI ...
-
bioRxiv - Microbiology 2024Quote: ... And a positive control reaction was performed where lysate was substituted with 2 µL (20 U) of purified Exonuclease I (NEB). Reactions were allowed to incubate for 1 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Diluted supernatants were used as the template DNA (5 μL) for qPCR using a 2×Luna universal qPCR master mix (New England BioLabs), with 0.5 μM of primers ...
-
bioRxiv - Neuroscience 2024Quote: ... The homology-directed repair (HDR) plasmid for C-terminal SAX-2::GFP(ju1831) was made using three-fragment Gibson Assembly (New England Biolabs) in which two sax-2 homology arms containing 498 bp upstream of the sax-2 TAA stop codon and 540 bp downstream of the sax-2 TAA stop codon plus the stop codon were amplified from N2 genomic DNA and fused such that they flanked GFP (pDD282) ...
-
bioRxiv - Immunology 2024Quote: ... and this point mutation introduces a premature stop codon and abolishes an Hpy118I site and the line was genotyped by PCR (primers in Table 2) and Hpy118I digest (NEB) (Supp Fig 1B) ...
-
bioRxiv - Immunology 2024Quote: ... The irf8 st95 mutation abolishes an AvaI restriction site and this line was genotyped by PCR (primers in Table 2) and AvaI digest (NEB), as previously described (Shiau et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 2μg (dual-guide) per well were set up using the Q5 Hot Start High-Fidelity 2× Master Mix (NEB #M0494) in a total volume of 50μl ...
-
bioRxiv - Biochemistry 2024Quote: ... pETDuet-1 vector was linearized by digestion with PacI and NdeI and gene fragments were inserted into multiple cloning site 2 (MCS2) of the linearized plasmid via Gibson assembly using the New England BioLabs (NEB) Gibson Assembly Master Mix and following the manufacturer’s standard protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was diluted 1:50 in ddH2O and 2 µL used as a template in a 15 µL reaction using the Luna Universal qPCR Master Mix (NEB) on a Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by excision and ligation for 2 hours at room temperature using the Instant Sticky-end Ligase Master Mix (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... The NEBuilder Assembly Tool was used to design primers for amplification of each component of the donor plasmid (Table 2) using Phusion (NEB); purified PCR products were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Deletion constructs were made by PCR amplification of the appropriate regions and cloned into the Cilantro 2 vector using Gibson cloning (New England Biolabs). Lentiviral particles carrying the respective constructs in the Cilantro 2 vector were produced and used to transduce MOLM-13 cells as described above ...
-
bioRxiv - Microbiology 2024Quote: ... The SARS-CoV-2 Spike coding region was then amplified using Q Hot Start High-Fidelity DNA Polymerase (New England Biolabs) with forward (5’ TCATCGATGCATGGTACGCCACCATGTTTGTTTTTCTTGTTTTATTG 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA pellet was resuspended in 50 µl of RNase-free H2O and 1 µl of the resuspended samples was used for quantification of the DENV-2 D220 NS5 RNA regions using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 10-ul reaction volume ...
-
bioRxiv - Physiology 2024Quote: ... Separate sets of cells were also collected and frozen in RIPA buffer containing 2 mM activated sodium orthovanadate (Na3VO4) (New England Biolabs) and 1% protease inhibitor cocktail (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA of 2×106 cells was extracted with the Monarch Total RNA Miniprep Kit with “on column” DNase I treatment (NEB). cDNA was generated by using LunaScript RT SuperMix Kit (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg of RNA was reverse transcribed using the ProtoScript II Reverse transcriptase kit from New England Biolabs (NEB #M0368S) and primed with oligo dT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µg genomic DNA per sample was mock treated or treated with 2 U/µg DNA of RNaseH (NEB, M0297) for 2 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL reactions were prepared for the second PCR by mixing 25 µL of 2× Phusion High-Fidelity PCR Master Mix (New England Biolabs), 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... The OsXLG crRNA target sequences were amplified using gene-specific primers (SI, Table 2) and Q5 Hi-Fi DNA polymerase (NEB). The PCR amplicons were subjected to Sanger sequencing and analyzed using CRISP-ID online software (Dehairs et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis was performed to engineer alanine or glutamic acid substitution mutations in Tax1bp1 using the primers listed in Table 2 and the Q5 site-directed mutagenesis kit (New England Biolabs). Open reading frames (ORFs ...
-
bioRxiv - Biophysics 2024Quote: ... We digested the pBS-parS for 2 h at 37°C using NotI-HF or XhoI restriction enzymes (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 1U RNasin) for 2 hours at 30°C and then incubated with 100 μL of Streptavidin Magnetic Beads (NEB) for 30 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... the bead array was put into a 1.5 mL centrifuge tube of 200 µL extension buffer (1x NEBuffer 2, 1mM dNTP, 25 units Klenow exo- (NEB M0212L)) ...
-
bioRxiv - Genomics 2024Quote: ... with a final extension of 72°C for 2 min using Q5 Hot Start High-Fidelity DNA Polymerase (NEB M0493L). PCR reactions were purified by PCR cleanup beads (UC Berkeley DNA Sequencing Facility ...
-
bioRxiv - Biophysics 2024Quote: The extracted genomic DNA was then subjected to NGS library preparation through a two-step PCR process using Q5 High-Fidelity 2× Master Mix (New England Biolabs). The first PCR step involved amplifying the genomic loci and attaching adapter sequences (primers listed in Table S10) ...
-
bioRxiv - Synthetic Biology 2024Quote: pDC011 variants with gRNAs that target the loci (Supplementary Table 2) were generated by Golden Gate assembly using AarI and T4 DNA Ligase (NEB). pDC011 is a derivative of pSL2680 (Ungerer & Pakrasi ...
-
bioRxiv - Biophysics 2024Quote: ... was obtained as previously described.2 Mutagenesis to produce additional isoforms and mutants was performed using the Q5 Site Directed Mutagenesis Kit (New England Biolabs). 1N4R tau was generated using by an initial round of mutagenesis with primers (5’-CTGAAGAAGCAGGCATTGG-3’ and 5’-CTTCCGCTGTTGGAGTGC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... 66 °C for 30 s, 72 °C for 30 s; and 72 °C for 2 min; Q5 Hot Start DNA polymerase [NEB]). PCR1 product was purified by SPRI beads (Mag-Bind TotalPure NGS ...
-
bioRxiv - Bioengineering 2024Quote: ... Cap-1 structures were then generated using the Vaccinia Capping System in conjunction with mRNA cap 2’-O-methyltransferase (both from New England Biolabs) for 45 minutes at 37°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... libraries were amplified with NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2) (New England Biolabs E7780) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2601) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Filtered (0.45 μm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 1 μM Ultramer was annealed with 1 μM T7-3G oligonucleotide in 1x Taq Buffer (NEB) in a final volume of 10 μl by heating the reaction up to 95°C for 5 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and 1 mM DTT containing [3H] SAM (25:1 molar ratio of SAM(NEB, Cat#B9003S) to [methyl-3H]-SAM (PerkinElmer ...
-
bioRxiv - Zoology 2020Quote: ... Briefly: agarose plugs were pre-incubated for 1 hour with 1× Cutsmart buffer (New England Biolabs), followed by overnight incubation with 20U restriction enzymes HinfI and 20U RsaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was then equilibrated twice in 1 ml of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (NEB or Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Then 0.3 μL of 1 mg mL−1 trypsin (trypsin-ultra, MS-grade, New England Biolabs) was added and samples were incubated at 37 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered (0.45 µm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... The oligonucleotides were mixed at a 1:1 ratio and phosphorylated with T4 PNK (NEB, M0201) and annealed in T4 ligase buffer (NEB ...