Labshake search
Citations for New England Biolabs :
1651 - 1700 of 1904 citations for 6 methoxypyridine 3 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sequence in a reaction containing 40 ng/μl DNA (4 μg total) and 0.5 U/μl restriction enzyme (HindIII-HF; NEB, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 5’ arm of homology to exon 5 of the Il22 gene was cloned into NotI-EcoRI-digested pMACs 4-IRES.II (contains EMCV IRES and truncated hCD4) using T4 DNA Ligase (NEB). Second ...
-
bioRxiv - Biophysics 2020Quote: ... After 1 hour of centrifugation at 100,000xg at 4 °C the supernatant was incubated with Chitin resin (New England Biolabs) for 30 minutes at 4 °C to remove metalloproteases ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcodes (4-8 bp) and common adapters were ligated with 400 U T4 DNA ligase (New England Biolabs Inc.) at 22 C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... The ligation of vectors with gRNA inserts was performed overnight at 4°C using T4 DNA ligase (NEB, M0202). The ligation products were then transformed ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were eluted by mixing the beads with 21µl RNase H Elution Buffer and 4 µl RNase H (New England Biolabs) and incubated at 37 °C for 30 min while shaking ...
-
bioRxiv - Microbiology 2023Quote: ... Reactions were set up as per manufacturer’s instructions with the addition of 4 units of Murine RNase Inhibitor (NEB) and 5% DMSO ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Bioengineering 2024Quote: S-R1-R2-H stock (87.5 kDa, 2 - 4 μM) tagged with handle oligos was reconstituted in 1x T4 ligase buffer (NEB) in PBS with 0.05% NP-40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... 1-3 μg RNA was used to generate sequencing libraries with NEBNext Ultra™ RNA Library Prep Kit for Illumina (#E7530L, NEB, USA) with poly(A ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and reverse primer (5’-AAG ATT CTC GAG ATG GTG ATG GTG ATG G-3’) were combined using the Q5 site-directed mutagenesis protocol (New England Biolabs, Ipswitch, MA). The resulting plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... The BAC containing viral cDNA was cleaved at a unique restriction site located downstream of the 3’-end poly(A) tail using NotI-HF (Ref. R3189S, NEB, Grenoble, France). In parallel ...
-
bioRxiv - Microbiology 2021Quote: ... HA tag sequences were added to the 3’ end of the hACE2 transgenic cDNA using a Q5® Site-Directed Mutagenesis Kit (NEB#E0554S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Cell Biology 2020Quote: The myo-3p::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974 ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.
-
bioRxiv - Genetics 2021Quote: Sequencing libraries were prepared from either 500 ng total RNA or 3 µl TraPR-enriched [80] sRNA with the NEBNext Multiplex Small RNA Library Prep Set for Illumina (E7300; NEB, Ipswich, Massachusetts) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared for sequencing by Cambridge Genomics Services using 3 μg of total RNA and an Ultra™ RNA library prep kit for Illumina (NEB, USA). Libraries were quantified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... EcoRV-digested amplicons encoding gRNA pairs were inserted into the vector in 3 separate Gibson assembly reactions (NEB Gibson Assembly Master Mix) according to manufacturer’s specifications ...