Labshake search
Citations for New England Biolabs :
1501 - 1550 of 1904 citations for 6 methoxypyridine 3 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Then a plasmid library was assembled using 4 independent reactions of NEBuilder HiFi DNA Assembly (New England Biolabs) to avoid biases in assembly that might affect the library’s distribution ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... pEXKm5 was digested with HindIII and the 4 fragments were assembled via Gibson cloning (New England Biolabs, E2611S).
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was synthesized from extracted RNA using 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were resuspended in 200uL digestion buffer with 4 uL protease (an equal volume of protease K (NEB) was substituted if the manufacturer-provided protease was exhausted ...
-
bioRxiv - Genomics 2019Quote: ... (iii) Polymerase for Ad2 amplification: Libraries #1 and #4 were amplified using Q5 high-fidelity DNA polymerase (NEB). Library #2 was amplified using Pfu Turbo Cx ...
-
bioRxiv - Molecular Biology 2020Quote: ... the single cell tagmentation product was mixed well with 4 units of Bst 3.0 DNA Polymerase (NEB, Cat.No.M0374) and indexed common primers (Vazyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Genomics 2021Quote: ... We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK, New England BioLabs Inc.), 5 μl of 10X PNK buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... Purified DNA fragments were ligated overnight at 4°C with T4 DNA ligase (New England Biolabs, Ipswich MA) per manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... annealed by temperature decrease from 95 °C to 4 °C and phosphorylated using T4 Polynucleotide Kinase (NEB, M0201) according to manufactures’ protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 12 h at 4 °C with 10 μg of Factor Xa protease (New England Biolabs, Hitchin, UK) per 1 g of mitochondria ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting Gβ1γ2 was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... Nicks were then ligated for 30 min at 37 °C using 4 units of Taq DNA ligase (NEB) in the presence of 0.5 μl thermopol buffer ...
-
bioRxiv - Immunology 2021Quote: ... into 384 well plates containing 0.5 µl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB), spun down and frozen at −80°C ...
-
bioRxiv - Biophysics 2020Quote: ... SecA(N95) K797C was overexpressed for 4 hours at 37 °C in E.coli NiCo21 cells (New England Biolabs) grown in 2xYT (Acumedia ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.
-
bioRxiv - Systems Biology 2024Quote: ... PLP ligation was performed for 4 hours at room temperature using 0.5 U/µl SplintR Ligase (NEB, M0375), 1x Ampligase ligase buffer ...
-
bioRxiv - Biophysics 2024Quote: ... A 4°C AKTA Pure FPLC system (Cytiva) was prepared with a 10 mL amylose column (NEB #E8021S) and 2 mL/min flow rate ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2023Quote: ... The resulting 40 μl of reaction product was mixed with 4 μl of T5 Exonuclease (New England Biolabs) in NEB Buffer 4 ...
-
bioRxiv - Biochemistry 2023Quote: ... and a final concentration of 1.4 nM of hRNase 4 and 0.15 U/μL of polynucleotide kinase (New England Biolabs). The reactions were incubated at 37°C for 1 h and stopped by addition of murine RNase inhibitor to a final concentration of 2 U/μL and incubation at room temperature for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... The ints-4 sgRNA was inserted into plasmid pDD162 via the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S). The sgRNA plasmid and repair template were Sanger sequenced to confirm correct construct assembly followed by microinjection into EG9882 strain with integrated Cas9 activity (10 ng µl-1 repair template ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Developmental Biology 2024Quote: ... The hsp-4 dsRNA was synthesized in vitro with a HiScribe™ T7 RNA Synthesis Kit (NEB, E2050). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... The unbound fraction was then incubated for 1 h at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... and washed 3 times with ice-cold 10 mM Ribonucleoside Vanadyl Complex (RVC) (New England BioLabs, cat.no. S1402S, Ipswich, Mass, USA) in buffer A (10 mM NaCl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 µl was mixed with 40 µL of 1x NEBuffer 3 supplemented with 10 mM MgCl2 and 5 units of Mbo I (New England BioLabs #R0147L). This reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3’UTRs were combined to the TagRFP-T CDS using the Gibson assembly Master Mix (Cat#E2611, New England BioLabs Inc). The resulting fragment was then amplified via PCR and digested prior ligation into a vector containing only Hofstenia promoter region ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized with SacI or XhoI (for transcription from T7 or SP6 promoter respectively) and 3’UTR fragment was transcribed in vitro using SP6 or T7 polymerases (New England Biolabs, UK) and the DIG RNA labelling Mix (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 pmol of an equimolar mixture of all gene-specific oligos for each gene were mixed with 250 pmol of the appropriate FLAP oligo in 1x NEBuffer 3 (New England Biolabs, B7003), then incubated in a Thermocycler (BioRad ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Physiology 2019Quote: ... 5’-TGTGCTGAGAAAACGCAGGT-3’ and sgRNA2: 5’-TGTCAACTGAAGGACCCAAG-3’) The template sequence was transcribed into RNA using a T7 RNA polymerase (New England Biolabs, E2040S) after which the DNA template was removed by treatment with RNase-Free DNaseI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-CACCAAAATGCTAAAGCCATCGATTATCTGCCTCTTTTTGGGCATTTTGGCGAAA TCATCGGCGGGCCAGTTCATGAAGGATAACACCGTGCCACTG-3’ and 5’-CTATTATCACAGTTCCTCTTTTTCTGCACTACGCAGGGATATTTCACCGCCCATCC AGGG-3’ were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing the E ...
-
bioRxiv - Cell Biology 2019Quote: ... Homologous 15bp overhangs on the 3’ end of the inverse PCR primers were ligated following the NEB T4 Ligation protocol (New England Biolabs # M0202S) to introduce the 5AA sequence ...
-
bioRxiv - Cell Biology 2019Quote: A derivative vector from modified TMPrtTA (3, 70) was created with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Backbone was digested with EcoRV-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... We tested various restriction digestion conditions in order to reliable separate all transgene copies (Sup. Fig. 3) and decided to perform overnight digestions with HindIII-HF or DpnII (NEB, USA) in CutSmart buffer ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Microbiology 2021Quote: ... the SAG1 3’UTR was amplified from pNJ-26 and cloned into the tagging plasmid to replace DHFR 3’UTR by Gibson assembly (NEB, E5520S). BAG1-mCherry GCaMP6f reporter tachyzoites were co-transfected with 10 μg of pSAG1::CAS9-U6::sgDHFR 3’UTR and 2 μg of PCR amplified P2A-mTagBFP2-HXGPRT flanked with 40 bp homology regions ...