Labshake search
Citations for New England Biolabs :
1651 - 1700 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We treated the crRNA with 4 U DNase I (NEB) to remove any remaining DNA templates for 15 minutes ...
-
Analysis of natural structures and chemical mapping data reveals local stability compensation in RNAbioRxiv - Biophysics 2024Quote: ... 4 μL of T7 RNA polymerase (New England Biolabs #M0251S), and 33 μL RNase-Free water ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL of 10X T4 DNA ligase buffer (NEB). The thermocycling protocol was 30 cycles of 5 min digestion at 37°C and 5 min ligation at 16°C ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was generated from Venus BBa_J176006 with primers 5’-tctgcacctgaggccaccatggtgagcaagggcgagg and 5’-ggtcacgaattccagcaggaccatgtgatcg via high fidelity PCR followed by spin-column purification (NEB #E0555, Sigma #NA1020). The YFP fragment and mutated pSBtet-GP plasmid were double-digested with Eco81I/ EcoRI (Thermo #FD0374 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... 5 mM CaCl2) with MNase (#M0247S, New England Biolabs). The obtained digest (mononucleosomes ...
-
bioRxiv - Microbiology 2020Quote: ... at the 5’ end and NotI (New England Biolabs) at the 3’ end ...