Labshake search
Citations for New England Biolabs :
1451 - 1500 of 3328 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 30 μL of 10x RE buffer 4 (NEB), 2 μL of exonuclease T7 (10,000 units/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 U of alkaline phosphatase from Biolabs (# M0290) and 5 mU of phosphodiesterase I from Sigma (# P3243-1VL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Genetics 2020Quote: ... 4 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Genomics 2020Quote: ... [4 µl 5x NEB FirstStrand buffer (NEB; E7421AA), 0.25 µl SUPERase-In ...
-
bioRxiv - Neuroscience 2021Quote: ... and the 4 base restriction enzyme Mse1 (NEB) under standard double digest conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 μl of Calf intestinal alkaline phosphatase (NEB) was added to dephosphorylate the RNA for 15 min at 37 °C ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 50% PEG-800 (New England Biolabs), 4 μl 10× T4 RNA ligase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 total U of Proteinase K (NEB) at room temp for 10 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and 4 units of Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Genetics 2021Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 4 μL T4 PNK (New England BioLabs) in a 100 μL reaction for 2 hours at 37°C and purified using Micro-Bio P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10 mM ATP (NEB, Cat #P0756S), 40U (2 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 72°C for 5 min) ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Genomics 2021Quote: ... exonuclease I (Exol) treatment was performed on all samples by adding 4 ul ExoI buffer and 4 ul ExoI (New England Biolabs, M0293L). Samples were incubated at 37 C for 30 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...