Labshake search
Citations for New England Biolabs :
1601 - 1650 of 4951 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.5 μL BsaI-HF® v2 NEBridge® Golden Gate Assembly mix (E1601, NEB, 5 μL final volume), and 0.5 μL T4 DNA ligase buffer was aliquoted across a PCR plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides corresponding to the ‘right’ half were 5′-phosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA). Equimolar amounts of ‘right’ strand ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of the polyC-tailed products were used with 1X Taq Mg-free Buffer (New England Biolabs), 500 nM of each primer (Table 2) ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... The fragments were re-phosphorylated at their 5’-hydroxyl groups using T4 polynucleotide kinase (New England Biolabs; M0201S) and purified using the miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... the samples were washed three times for 5’ each with PBS-0.01%Tween and incubated with 0.24 mg/ml Monarch RNase A (New England Biolabs) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg total RNA was subjected to poly(A) mRNA isolation according to the manufacturer’s protocols (NEB, #E7490). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Microbiology 2020Quote: ... followed 1 hr recovery in 1 mL pre-warmed SOC (NEB) at 37°C 250 rpm ...
-
bioRxiv - Biochemistry 2019Quote: ... 1/20-1/50 (w/w) GluC protease (New England BioLabs) was added and incubated 24-48 h at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... The chamber was incubated with 1 mg ml−1 streptavidin (NEB) and washed with MBCT ...
-
bioRxiv - Microbiology 2020Quote: ... 1 U of DNase 1 (New England Biolabs, Ipswich, MA US) per ∼100 µl lysate (37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μl Cutsmart buffer and 1 U Sau96I (New England Biolabs) were added into the system ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 unit/µl T4 RNA ligase 1 (New England Biolabs, M0204S) and incubated at 23°C for 150 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 1 unit mL-1 SfoI restriction enzyme (NEB) was injected to generate blunt-end DNA molecules.
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Genetics 2021Quote: ... Tagmented library was amplified with P5_BRB and BRB_Idx7N5 primers (5 μL, Supplementary Table 14) using NEBNext UltraTM II Q5 Master Mix (NEB, M0544L) which was incubated at 98 °C for 30 sec before adding DNA with the following conditions ...
-
bioRxiv - Genetics 2021Quote: ... and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S, NEB), 6μl biotinylated bridge linker (200ng/ul) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... at 50°C for 60 min with a subsequent Klenow DNA polymerase step using 5 units (New England Biolabs) at 37°C for 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: The RNA primer was labelled at the 5’ terminus with [γ-32P]ATP using T4 PNK (New England Biolabs) and PAGE purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... eight rounds of linear amplification PCR reactions with 40μg genomic DNA were performed with 5 μg genomic DNA each using HS Flex polymerase (NEB) and biotinylated Myc primer (Table S2) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... were radiolabeled at the 5’-end with 32P using the manufacturer recommended protocol for T4 PNK (New England Biolabs) and ATP [g-32P] (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Approximately 5 μg of each PcCel6A mutant gene in pPICZα was linearized by restriction enzyme PmeI (New England Biolabs) for the transformation of P ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Plant Biology 2021Quote: ... Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB). DNA was recovered after reverse crosslinking and Proteinase K treatment (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The holder allowed immersion of the cochlea and the middle ear in oxygenated (95 % O2, 5 % CO2) cell culture medium (Minimum Essential Medium with Earle’s balanced salts, SH30244.FS Nordic Biolabs). The bone of the bulla was removed gently with bone cutters which exposed the middle ear and the basal turn of the cochlea ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of total RNA was purified using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Massachusetts). Libraries were constructed using the ULTRA II directional library kit (New England Biolab ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Cancer Biology 2021Quote: ... We performed 5 or 20 Gibson assembly reactions for tiling or genome-wide sgRNA library followed by manufacturer’s instructions (NEB) and purified DNA using ethanol precipitation ...
-
bioRxiv - Genomics 2022Quote: ... A circular form of the 3I_RAN FLEXI synthetic oligonucleotide control was generated by incubating the 5’phosphorylated-3I_RAN FLEXI oligonucleotide (500 ng) with T4 RNA Ligase I (10 U; New England Biolabs) for 2 h at 25 °C and 2 min at 95 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions contained approximately 5 μL of isothermal assembly mix (prepared similar to as previously described12) or NEBuilder HiFi (NEB), 0.01 pmol of plasmid linearized via SpRYgest ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genomics 2022Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2mM Vanadylribonucleoside complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’end of RNA was phosphorylated and labelled by γ-[32P] ATP using T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 45 min ...