Labshake search
Citations for New England Biolabs :
1551 - 1600 of 10000+ citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and T4 ligase buffer (NEW ENGLAND BioLabs, cat # M0202V). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.3 μl of T4 DNA ligase I (NEB, M0202L), 6.25-µl of double-stranded barcoded oligonucleotides (1st set of sub-barcodes ...
-
bioRxiv - Genetics 2024Quote: ... and 50 μL T4 DNA Ligase (NEB cat no.M0202L). Ligation reactions were cooled to 16°C and incubated for 6 h ...
-
bioRxiv - Plant Biology 2024Quote: ... These were then ligated with T4 DNA ligase (NEB) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and assembled in vitro using T4 ligase (M0202M, NEB) along with hairpins at both ends ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR amplicons were subsequently ligated using T4 ligase (NEB) in a reaction with DpnI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... dGTP and 36 Units of T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 U T4 polynucleotide kinase (New England Biolabs) in a final volume of 10 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA footprints were phosphorylated using T4 PNK (NEB, M0201S) for 30 min in 37°C and washed three times in RIPA buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 1X T4 RNA Ligase Buffer (New England BioLabs) supplemented with 35% w/v PEG-8000 and incubated at 37°C for three hours ...
-
bioRxiv - Microbiology 2023Quote: ... Quick CIP and T4 DNA ligase (New England Biolabs) described by the manufacturer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... standard ligations were performed using T4 DNA ligase (NEB), while Gibson assembly reactions used the NEBuilder(R ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA footprints were phosphorylated using T4 PNK (NEB, M0201S) for 30 min at 37°C and washed three times with RIPA buffer ...
-
bioRxiv - Genomics 2022Quote: ... from ONTs ligation sequencing kit (ONT, SQK-LSK109) and 10 µl of NEBNext Quick T4 DNA Ligase (New England Biolabs, E6056S). Ligation mix was incubated at RT for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The digested fragments were gel-purified and then cleaned up using a GenepHlow™ Gel/PCR Kit before ligation into the appropriate vector using T4 ligase (New England Biolabs). The ligated plasmids were transformed into DH5α ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer, 2 µM oBZ407_preA preadenylated linker, 100 units NEB T4 RNA ligase 2, truncated) and they were further incubated at 37 °C for 3 hrs ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sheared and pulled down DNA was treated using a 100μl end-repair reaction (25mM dNTPs, 50U NEB PNK T4 Enzyme, 12U NEB T4 DNA polymerase, 5U NEB DNA pol I, Large (Klenow) Fragment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were incubated with T4 DNA polymerase (New England Biolabs) in NEBuffer 2.1 (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... then ligation via T4 DNA ligase (all enzymes from NEB) to yield pCglBWT ...
-
bioRxiv - Biophysics 2021Quote: ... For the ligation 800 units of T4 DNA ligase (NEB) were added and the reaction was held overnight at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... T4 DNA ligase (Cat. No. M0202L; NEB; use 1000 units), 5’-deadenylase (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... and ligated into the pTP backbone47 using T4 ligase (NEB). Positive clones were identified by colony PCR and cultured in 100 ml of LB Broth containing 100 µg/ml Ampicillin ...
-
bioRxiv - Genomics 2021Quote: ... T4 DNA polymerase (Cat. No. M0203S; NEB; use 0.25 uL), ATP (final concentration = 0.8 mM) ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by T4 DNA Ligase reaction (New England BioLabs, M0202S). BRSK1 WT and T189A vectors were obtained from MRC PPU Reagents and Services (DU1236 and DU1242 ...
-
bioRxiv - Immunology 2021Quote: ... Ligations were performed with T4 DNA Ligase (New England BioLabs). All PCR products were purified with the QIAEX II Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... Annealed sgRNA were ligated with T4-DNA ligase (NEB #M0202S) for 1 hour at 37°C into pPB_U6::gRNA_EF1a::BFP-Puro digested with BlpI (NEB #R0585S ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted to 100 μL and ligated with T4 ligase (NEB). The resultant ligation was used as a template for inverse PCRs ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S), 0.5 μL 200x BSA (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 U/uL of T4 RNA Ligase 2 (NEB M0351S), 1X T4 RNA Ligase Reaction Buffer (NEB B0216L) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of 10X T4 RNA ligation buffer (NEB B0216L), 2 uL of 10mM ATP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1X T4 DNA ligase reaction buffer (New England Biolabs). Ligation reactions were incubated at room temperature for 40 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (10 U/μl) of T4 polynucleotide kinase (NEB) and 1 μl of 10 mM dNTPs in a final volume of 50 μl at 24°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Microbiology 2022Quote: ... PEG 8000 (17.5% final) and T4 RNA ligase 2 (NEB) in 1x T4 RNA ligase buffer at 25°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... equilibrated in 100 μl 1x T4 RNA ligase buffer (NEB) containing 40 μl 50% PEG 8000 for 1 hour at room temperature then incubated overnight at 25°C in 100 μl 1x T4 RNA ligase buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.5 units/µl T4 RNA Ligase 2 (NEB, M0239S), with the enzyme added after the other components had been mixed and incubated at 23°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... ONT adaptor ligation was performed using T4 DNA ligase (NEB). The resulting DNA was purified by Agencourt XP beads ...
-
bioRxiv - Genomics 2019Quote: ... P2 adapter was ligated using concentrated T4 DNA ligase (NEB) and 50 ng of the ligated product was engaged in a 12 cycles PCR ...
-
bioRxiv - Genomics 2020Quote: ... and T4 DNA ligase (2M U/mL; New England BioLabs) were mixed and incubated for 10 min ...
-
bioRxiv - Biophysics 2019Quote: ... and 3.1 µL of T4 ligase buffer (NEB, cat# B0202) at 37°C for 2-4 hours ...
-
bioRxiv - Microbiology 2019Quote: ... and then modified using T4 Polynucleotide Kinase (New England Biolabs), which removes the 3’-phosphate and adds 5’-phosphates ...
-
bioRxiv - Genetics 2019Quote: ... followed by treatment with T4 polynucleotide kinase (New England BioLabs) as described previously53 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and dNTPs in 1× T4 DNA ligase reaction buffer (NEB), followed by dATP-addition with Klenow ...
-
bioRxiv - Synthetic Biology 2020Quote: ... NotI and T4 DNA ligase (New England Biolabs, MA, USA); Type IIS assembly with BsmbI (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by ligation with T4 DNA ligase (New England Biolabs) and transformation into DH5a competent E.coli cells (Thermo Fisher Scientific) ...