Labshake search
Citations for New England Biolabs :
1551 - 1600 of 4045 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and one short read library using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England BioLabs Inc., Ipswich, MA, USA). The long-read library was then sequenced on the PacBio Sequel IIe system in CLR mode using the Sequel II Binding Kit 2.2 (PacBio) ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 viral RNA detection and quantification was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, Whitby, ON, Canada) on the Rotor-gene Q platform (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... The strain CBS 411.78-was prepared and sequenced with the ligation kit SQK108 in a one-pot reaction using 500 ng DNA for end prep and ligation (NEB Ultra-II ligase) and sequenced on an R9.4.1 flowcell ...
-
bioRxiv - Cell Biology 2024Quote: ... falciparum in placenta samples was evaluated using One Taq® Quick-Load® 2X Master Mix with Standard Buffer (NEB, Cat No. M0486L) and the following thermocycler program ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Then total RNA (500 ng per sample) was purified by one round of polyA mRNA selection with oligo-dT magnetic beads (NEB, Cat. No. S1550S), converted to cDNA using KAPA mRNA HyperPrep kit (KAPA biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10% NP-40 (New England Biolabs) at 37°C for 60 mins.
-
bioRxiv - Genetics 2021Quote: ... 10 μL of Proteinase K (NEB, P8107S) was added to each sample and the sample was mixed well by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antarctic phosphatase from NEB (# M0289S-10 units), snake venom phosphodiesterase I (0.2 units ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of T4 DNA ligase (NEB), and 3 μl of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 10 units of Exonuclease V (NEB) in nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... 0.3 µL of 10 mM ATP (NEB) and 0.33 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... 10 U of RNase Inhibitor (Murine, NEB), 0.5 mM each dNTP mix and 5 mM DTT in a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µM (nucleotide) linear φX174 dsDNA (NEB) was added to the mixture to initiate the three-strand exchange reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl 10mM ATP (New England Biolabs), 2 μl T4 ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2020Quote: ... We added 10 µL rSAP (NEB #M0371L) and incubated at 37°C for 1 h to prevent plasmid re-ligation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 μL of 10 mM biotin (NEB) was then added to each sample on the plate and incubated for an additional five minutes to compete away purely biotin-dependent interactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 U μL-1T4 Rnl2 (truncated) (NEB) and incubating for 3 hr at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U of AMV reverse transcriptase (NEB) was added ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH 10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 U DpnI (New England BioLabs #R0176L) was added and sample processing continued as described [49].
-
bioRxiv - Cell Biology 2022Quote: ... 10 ul of 10X G5 buffer (NEB), and 1ul of Endo H HF (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and treated with 10 units RppH (NEB) and 30 units T4 PNK (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 10 U of T7EI ((M0302S, NEB, USA) was added and incubated at 37 ℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs). Lysates were centrifugated at 14,000 g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... 10 U of T4 DNA ligase (NEB) and 33µl of T4 DNA ligase buffer (10x ...
-
bioRxiv - Systems Biology 2019Quote: ... and 10 U of RNase H (NEB) with RNase H buffer (10X ...
-
bioRxiv - Cell Biology 2019Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Genetics 2019Quote: ... and 10 U DNA polymerase I (NEB), made up to a final volume of 50 μl with H20.
-
bioRxiv - Genomics 2019Quote: ... 10 mg/ml BSA (NEB, Ipswich, America), T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... MNase (10 Units/sample; New England Biolabs) was added and reactions were incubated for 40 min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (New England Biolabs) was grown at 37 °C in LB medium supplemented with appropriate antibiotics as necessary for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... 10 units of BstUI (Nex England Biolabs) were added to each reaction and incubation was conducted at 37°C for 3 h ...
-
bioRxiv - Genomics 2020Quote: ... 10 U T4-βGT (NEB, Ipswich, MA). The reaction was initiated by adding Fe (II ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl 5x GC Buffer (NEB, USA), 1 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...