Labshake search
Citations for New England Biolabs :
1501 - 1550 of 7563 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction described above included another 2 µL of mRNA cap 2′-O-methyltransferase (50 U/µL, NEB). The capping reaction was incubated at 37°C for 4 h ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2020Quote: ... 3’-end RNA dephosphorylation was performed on beads with PNK (NEB M0201L) for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µl Ultra II End-prep enzyme mix (New England Biolabs). Samples were incubated at 20°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ adaptor was ligated to the cDNA using T4 ligase (NEB; M0202S). The cDNA was purified using Dynabeads myOne SILANE (life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ ends were dephosphorylated with T4 polynucleotide kinase (T4 PNK; NEB) in the following reaction mix ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μL of Ultra-prep enzyme mix (New England Biolabs, UK), and completed with molecular biology grade water ...
-
bioRxiv - Cell Biology 2022Quote: ... these cells were treated with 3 µM SNAP-Cell TMR-Star (NEB) for 30 min at 37°C and washed in 10% FBS DMEM for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB, E7546), incubated for 10 min at room temperature followed by 10 min at 65 °C ...
-
bioRxiv - Microbiology 2023Quote: ... using Phusion High Fidelity polymerase with HF buffer and 3% DMSO (NEB) under the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µg were DNAsed with DNase I treatment (New England Biolabs). RNA was directly ribodepleted with the riboPOOL kit (siTOOLs ...
-
bioRxiv - Biophysics 2023Quote: ... The sample was treated with 3 U/μL of micrococcal nuclease (NEB) in 50 mM HEPES-KOH pH 7.4 ...
-
bioRxiv - Bioengineering 2023Quote: ... catalog #70015-3) using T4 DNA ligase (New England Biolabs, catalog #M0202L). We then packaged ligation reactions using T7Select415-1b cloning kit (Novagen (EMD Millipore) ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of NEBNext Ultra II End Prep Enzyme Mix (NEB) were added to each sample and mixed well by pipetting up and down ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ RNA adaptor was ligated with T4 RNA ligase (NEB) to synchronize with IP samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ DNA adaptor was ligated with T4 RNA ligase (NEB). qPCR was then used to determine the required amplification ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a 3′ RNA adaptor was ligated with T4 RNA ligase (NEB). 8% of IP and input samples were run on an analytical 4–12% PAGE gel ...
-
bioRxiv - Bioengineering 2024Quote: ... a mixture composed of 3 µL USER® Enzyme (New England Biolabs) and 30 µL of the library amplification master mix was combined with 17 µL of the product from the sec-ond post-ligation cleanup ...
-
bioRxiv - Biochemistry 2024Quote: ... with [γ-32P]-ATP or at the 3′ ends using Klenow (NEB) with [a-32P]-dATP and [a-32P]-TTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB, E7546), incubated for 10 min at room temperature followed by 10 min at 65 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... mixed with 3 μl 10% SDS and 1.8U Proteinase K (NEB #P8107S) and incubated overnight at 55°C ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We treated the crRNA with 4 U DNase I (NEB) to remove any remaining DNA templates for 15 minutes ...