Labshake search
Citations for New England Biolabs :
1351 - 1400 of 7563 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μl T4 DNA Polymerase (NEB, cat#M0203S, 3 U/μl) and 0.1 μl Taq DNA Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL NEBNext End Prep Enzyme mix (New England Biolabs, USA), 2.5 µg fragmented DNA and adjusted to 50 µL with nuclease free water (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... ligated to a 3’ adaptor using T4 RNA Ligase I (NEB), and purified using SDS-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Genomics 2021Quote: ... mixed with 3 μL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Biophysics 2020Quote: ... GRN-3 was expressed in SHuffle™ cells (New England Biolabs), while GRN-5 was expressed in Origami 2 DE3 (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... mixed with 3 μL 4x LDS loading dye (New England Biolabs) and loaded onto 4-12% NuPAGE Bis-Tris gels (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in NEB next Quick ligation buffer (3 μl, New England Biolabs) in the presence of 1 μl RNA CS (Oxford Nanopore Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Genomics 2023Quote: ... 25 pmol of SSAs were folded in 1x NEBuffer 3 (NEB) by heating at 95°C for 5 min followed by slow cooling to 25°C ...
-
bioRxiv - Genomics 2023Quote: ... was digested for 3 hours with PvuII-HF (NEB cat #R3151S) or PstI (NEB cat #R0140T ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Genetics 2022Quote: ... and a 3’ loxP site in a HiFi Assembly reaction (NEB) with pBS-ISceI to give pBSIce-gata2aKI (Supplementary File 1).To construct a foxc1a targeting vector ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3′ adaptor ligation using T4 ligase (New England Biolabs). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... All samples were mixed with 3 μl Proteinase K (NEB P8107S) and incubated for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ adenine (A) overhangs were then added by Taq (NEB) PCR and cloned into the TOPO-TA plasmid (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 3 mM CaCl2) and was subjected to mild MNase (NEB, M0247S) treatment (20 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: NEBNext 3’ SR adaptors for Illumina (New England Biolabs, cat# E7332) were ligated to the 3’ ends of total RNA from EVs and cellular samples isolated from an RN cell line using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... at 37°C for 3 hours in 1x CutSmart buffer (NEB). The digested plasmid was then visualised by agarose gel electrophoresis and the digested plasmid purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: H in the reaction buffer containing GlycoBuffer 3 (B1720S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA oligonucleotides were labeled in 3’ using poly(U) polymerase (NEB) and [α-32P]UTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... We prepared α2-3 neuraminidase (P0728L, New England Biolabs, Ipswich, MA) at 250 U/mL in GlycoBuffer1 (50 mM sodium acetate ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...
-
bioRxiv - Microbiology 2021Quote: ... Linearized DNA was purified by phenol/chloroform extraction and RNA was in vitro transcribed in the presence of G(5’)ppp(5’)G RNA Cap structure analog using SP6 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and ligating 5 µL of 5 µM spacers (annealed oligos) with 80ng of BsaI-digested backbone using the T4 ligase (NEB). We chose spacer sequences based on protospacer position and their association with a 5’-AAG-3’ motif and annealed them from two oligonucleotides with the according restriction site overhangs (95 °C for 5 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Second DNA adapters (containing 5 [N5] or 10 [N10] random bases at the 5′-end) were ligated to the 5′-end of the cDNA (T4 RNA Ligase, NEB). The DNA was amplified by PCR and purified with PippinPrep system (Sage Science ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Genomics 2022Quote: Add 5 μl of dNTP mix (10 mM each) and 5 μl of DNA polymerase I Klenow fragment (NEB, M0210) to the reaction system ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting cDNA was then amplified by PCR using the PBAD 5’- RACE universal primer (5’ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT3’) and the S17-specific primer IgBP3151-171R (5’CTTGCGATCTCGGGCTAAATCCACCA3’) in the presence of Q5 DNA polymerase (NEB) and dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...