Labshake search
Citations for New England Biolabs :
1501 - 1550 of 2641 citations for Porcine Circovirus 2 PCV2 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.27 nmol ErCas12a/LbCas12aU protein and 0.45 nmol crRNA were assembled in 1 X Nuclease Reaction Buffer (NEB). The protein and RNA were mixed and incubated for 10 minutes at room temperature and used for transformation of embryogenic C ...
-
bioRxiv - Biochemistry 2023Quote: ... and then deglycosylated and dephosphorylated overnight at 37 °C with the protein deglycosylation mix II (New England Biolabs) and Quick CIP (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... samples containing the same amount of protein (20 µg/sample) were processed for endoglycosidase-H (Endo-H, NEB) digestion using 5 milliunits Endo-H for 16h at 37°C ...
-
bioRxiv - Immunology 2024Quote: The puromycin-conjugated mRNA templates were translated using a PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) with the addition of PURExpress Disulfide Bond Enhancer (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... cell-free transcription-translation assays were carried out using the PURExpress® In Vitro Protein Synthesis Kit (NEB) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... Purified 6xHis-TEV-PK was supplemented with 10 mM MnCl2 and 4,000 U of lambda protein phosphatase (NEB), and incubated at 30°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... MBP tagged protein was subsequently bound in batch for 1 h to 1 ml of Amylose resin (NEB) per litre of input culture (typically 4 ml total resin) ...
-
bioRxiv - Plant Biology 2024Quote: ... The proteins were purified using the amylose resin affinity purification method by following the manufacturer’s recommendations (E8021L, NEB). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: HA-tagged BirA-Tau fusion proteins were generated by using the NEBuilder™ HiFi DNA Assembly Kit (NEB). To this end ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ribosome nascent chain complexes were generated using the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800S). A 100 µL reaction was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ribosome/nascent chain complexes (RNCs) were generated with a PURExpress In Vitro Protein Synthesis Kit (New England Biolabs, E6800S ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen productionbioRxiv - Plant Biology 2021Quote: ... 2 µL of cDNA mix was added to 50 µL Phusion High-Fidelity DNA Polymerase (NEB) reaction mix ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 RBD were conjugated to SNAP-Capture Pull-Down resin (New England BioLabs). For each conjugation ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pulse step was performed with 2 µM SNAP-cell TMR Star (New England Biolabs, S9105S) for 15 min followed by two washes with medium ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cell Biology 2022Quote: ... after which 2 µL of Recombinant PNGaseF (Glycerol-free) (New England Biolabs, Ipswich, MA; catalog # P0709L) was added to each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR was performed with Q5 Hot Start High-Fidelity 2 × Master Mix (#M0494L, New England Biolabs) with the amount of input genomic DNA (gDNA ...
-
bioRxiv - Genetics 2020Quote: ... 10 μL re-annealed PCR product was digested with 2 units T7 Endonuclease I (NEB #M0302L) in NEBuffer 2 for 60 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Immunology 2021Quote: ... PCR reaction was performed using OneTaq® 2× Master Mix with Standard Buffer (New England Biolabs). Primers sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then inserted into pU6-2-gRNA plasmids using T4 DNA ligase (New England Biolabs # M0202S).
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... an aliquot of approximately 10 μg of RNA was treated with 2 units of DNase (NEB) in a final volume of 100 μL for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Plant Biology 2023Quote: ... the pMIR319C containing pMW#2 reporter constructs were linearized with XhoI (R0146, New England Biolabs, USA) and integrated into the mutant HIS3 locus of the YM4271 host strain (Gift from Ram Yadav ...
-
bioRxiv - Microbiology 2023Quote: ... mmpL10 and papA3 and the flanking intergenic sequence was amplified using Q5 HiFi 2× MasterMix (NEB) from genomic DNA isolated from M ...
-
bioRxiv - Cancer Biology 2023Quote: ... the samples were end-repaired by adding 2 μl NEBNext FFPE DNA Repair Mix (NEB, M6630) and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 2 hours at 37°C in 1X T4 PNK buffer (New England Biolabs, cat#B0201S). Radioactively labeled tRNAs were produced by T7 in vitro transcription in the presence of [α-32P]-UTP (PerkinElmer ...