Labshake search
Citations for New England Biolabs :
1451 - 1500 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... which were then degraded by the 5’-3’ ssDNA exonuclease RecJ (NEB, M0264S). After rRNA reduction using the riboPOOL rRNA depletion kit (siTOOLs Biotech ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Microbiology 2020Quote: ... incubated overnight at 4°C and treated with DNAse I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The following 4 fragments were amplified using the Q5 high fidelity polymerase (NEB) and combined using Gibson assembly (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... and then held at 4°C until a subsequent T7 Endonuclease I (NEB) treatment at 37°C for 30 to 90 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 15 µL of labeling mix (4 µL 10X ThermoPol Reaction buffer (NEB, B9004S), 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP ...
-
bioRxiv - Bioengineering 2021Quote: ... (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2 ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µl of 10x DNase buffer and 4 µl DNase I (NEB Inc.) were added and incubated at 37°C for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... Mutations in hSlo1 and β1/4 were introduced by PCR-mediated mutagenesis (NEB) using oligonucleotide primers (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... 4% Glycerol and 0.1 mM DTT) with 75 µM S-Adenosylmethionine (SAM, NEB), varying amounts ssRNA and duplex RNA (see above) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was mixed with 7.1 μl H2O and 0.9 μl NEB 4 buffer (NEB). After incubating for 10 min at 96°C ...
-
bioRxiv - Genomics 2023Quote: ... The DGP-4 fragments were then cloned into the AscI/NheI (NEB, USA) site of the p200 vector to construct the sgRNA library (p200 library ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 U/mL creatine kinase) containing 10 µMnt cssDNA (NEB, PhiX virion DNA) was supplemented with Rad51 (5 µM ...
-
bioRxiv - Cell Biology 2023Quote: ... Adapter-ligated DNA was digested with 4 µL of EcoRV-HF (NEB, R3195), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The gel fragments were incubated with 4 mg/mL proteinase K (NEB, P8107) in PK buffer (100 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... The probes were then digested with 4 uL RNaseH (New England Biolabs M0297S) and 4 uL RNaseA (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Genomics 2019Quote: ... approximately 1 ug of genomic DNA or WGA-DNA (See Suppl. Table 1) was dephosphorylated with Quick calf intestinal phosphatase (NEB) and CutSmart Buffer (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).