Labshake search
Citations for New England Biolabs :
1401 - 1450 of 7574 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... primers 5’ caccGGAACAGGCAACATGATTGA 3’ and 5’ aaacTCAATCATGTTGCCTGTTCC 3’ were annealed and golden gate assembled using BpiI (Thermo Fischer) and T4 Ligase (NEB) into s23_U6_scaffoldv2 backbone having BpiI cut sites downstream of U6 promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... (5’-Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3’-InvdT) was ligated to the 3’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Master mix was added to each sample together with 1 µl truncated T4 RNA Ligase 2 (#M0239, NEB; Frankfurt/Main, Germany). Ligation was carried out for 2 h at 23°C and nucleic acids were precipitated ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Pathology 2019Quote: ... protocol using the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit (ONT) and LongAmp Taq 2× Master Mix (New England Biolabs, MA) with the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... was linerized by inverse PCR with primers 13 and 14 and the duplex oligo was ligated to the linearized plasmid in a 2:1 insert:vector molar ratio using NEBuilder Hifi Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was converted using the Enzymatic Methyl-seq conversion module (NEB) following manufacturer’s instructions with slight modifications ...
-
bioRxiv - Genomics 2024Quote: ... teleta were assayed by Enzymatic-Methyl seq (EM-seq) (NEB #E7120) according to the manufacturer-provided protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2019Quote: ... 20 µl of template, 20 U of exonuclease I, 5 U of Antarctic phosphatase, 1× Antarctic phosphatase buffer; New England Biolabs, Frankfurt, Germany); incubation conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2019Quote: ... NEB One Taq One-Step RT-PCR Kit (NEB # E5310S) was used for nucleic acid amplification ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 2-5 unites of RNase H (New England Biolabs) in 5 µl of 1x RNase H buffer were added to the annealed RNA-chimeric oligo mixture and the RNase H cleavage reaction was performed at 37o C for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µl of Taq 5× Master Mix (New England Biolabs) and Milli-Q water ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... we performed 2 reactions per sample (20 µl 5× NEB Q5 buffer ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 2h at 37C with 1x T4 Rnl2 Reaction buffer (NEB B0239SVIAL), 1 U/µl T4 Rnl2 (NEB #M0239) ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...