Labshake search
Citations for New England Biolabs :
101 - 150 of 3150 citations for Trypsin 1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid sequencing and glycan localization were carried out by digesting the antibody samples with trypsin or chymotrypsin (New England Biolabs, Ipswich, MA) followed by LC-MS/MS analysis of proteolytic fragments with an Orbitrap Fusion (Thermo ...
-
bioRxiv - Biochemistry 2020Quote: ... and peptides in one aliquot were deglycosylated by further treatment with 125 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA) for 16 h at 37 °C.
-
bioRxiv - Cell Biology 2021Quote: ... were made by cloning synthetic gene fragments encoding the CBS or TAT peptide sequences into NdeI and BamHI sites in pMAL-c5x (New England Biolabs, Ipswich, MA). The encoded cargo proteins thus have either a CBS or TAT sequence C-terminal to the MBP and a 6x His tag beyond.
-
bioRxiv - Microbiology 2020Quote: ... 25 μg of protein was precipitated from cell lysate as described in Methods and treated with peptide-N-glycosidase F (PNGase F; New England Biolabs, MT, USA) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... behind the α-factor signal peptide sequence using SmaI/EcoRI restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, MA, USA). Here ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were dried in a speed vac before peptides were deglycosylated with Endo H or PNGase F according to manufacturer’s instructions (P07025 & P0710S, New England Biolabs Inc., Hitchin, United Kingdom).
-
bioRxiv - Cell Biology 2022Quote: ... The DNA encoding the EGFP-fusion proteins and the P2A peptide was inserted by Gibson assembly using NEBuilder HiFi DNA assembly master mix (New England BioLabs, Ipswich, MA, USA). The HeLa Flp-In T-REx K44A Dynamin2-EGFP-P2A-Caveolin1-mCherry construct was obtained by in vitro mutagenesis of the pcDNA/FRT/TO/Dyn2-EGFP-P2A-Caveolin1-mCherry construct exchanging lysine at position 44 to an alanin using these primers ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA encoding EHD2-BFP and the P2A peptide was inserted by Gibson assembly using NEBuilder HiFi DNA assembly master mix (New England BioLabs, Ipswich, MA, USA). The Flp-In TRex HeLa cell lines were maintained in DMEM supplemented with 10% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Microbiology 2022Quote: The recombinant constructs (pETDuet-1-TaPHB-1 and pETDuet-1-TaPHB-1-RUVBL1 were separately transformed into E. coli Lemo21(DE3) (NEB) chemical competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM MgCl2) supplemented with 1 mM ATP and 1 U/μL RNase Inhibitor (NEB). Reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 unit µL-1 EcoRI-HF (New England Biolabs)) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 U μL−1 murine RNase inhibitor (NEB, M0314L), 600 ng mRNA and 50 μM PF846 in 1% DMSO ...
-
bioRxiv - Genomics 2021Quote: ... 1 unit/μl RNA ligase 1 (New England Biolabs), 1× RNA ligase buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl 40 U/μl−1 RNase Inhibitor (NEB), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1 U μl−1 RNase inhibitor (NEB), or bulk sorted into buffer RLT Plus (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 μl T4 DNA Polymerase (1 U, NEB). Gap-filling reactions purified using the Zymo Research kit and eluted with 6 uL water ...
-
bioRxiv - Microbiology 2024Quote: ... and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB) and T4 ligase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl 40 U μl-1 RNase Inhibitor (NEB, M0314), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 ul T4 RNA ligase 1 (10U/ul – NEB M0204), 0.5 ul 100 uM 5’ RNA linker (Blocked at 5’ end & contains NNNN at 3’ end for barcoding) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 U/μL T4 RNA ligase 1 (New England Biolabs), 1.3 U/μL Ribolock RNase inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... 1 ul i7 and 1 ul i5 (from NEB #E7600S), 8 ul 1st PCR product after SPRI beads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:100 or 1:1000 (stock 10 mg/mL, NEB) or with 1:10 Dnase I (stock 2 U/μL ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL of 0.4 µg µL-1 Lys-C (NEB) stock was added (enzyme:substrate ratio of 1:100 w/w ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested briefly (< 1 min) by 1% Proteinase K (NEB) in TE buffer at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB) in 7 μL Ezra buffer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 1 U of T7 endonuclease 1 (New England Biolabs) and NEB Buffer 2 were added ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:50,000 (NEB, and anti-GST HRP conjugates ...
-
bioRxiv - Microbiology 2020Quote: ... followed 1 hr recovery in 1 mL pre-warmed SOC (NEB) at 37°C 250 rpm ...
-
bioRxiv - Biochemistry 2019Quote: ... 1/20-1/50 (w/w) GluC protease (New England BioLabs) was added and incubated 24-48 h at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... The chamber was incubated with 1 mg ml−1 streptavidin (NEB) and washed with MBCT ...
-
bioRxiv - Microbiology 2020Quote: ... 1 U of DNase 1 (New England Biolabs, Ipswich, MA US) per ∼100 µl lysate (37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μl Cutsmart buffer and 1 U Sau96I (New England Biolabs) were added into the system ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 unit/µl T4 RNA ligase 1 (New England Biolabs, M0204S) and incubated at 23°C for 150 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were mixed 1:1 with 2x RNA dye (NEB B0363S), loaded on TBE gels ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 1 unit mL-1 SfoI restriction enzyme (NEB) was injected to generate blunt-end DNA molecules.
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.